ExifMM*bj(1r2i-'-'Adobe Photoshop CC (Windows)2018:12:19 17:21:08&(.HH Adobe_CMAdobed            k" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?5I8%A0Wf=6f0fS}ΖR9lUl mk^ƹ qcNe4Hk$pǼOIԓܔ1FڍH=Ѯ x4G2 %4w @s}pLhOMi.u RI%")05{yj<^u:;=8f0cRGguNcv,g:ݱ F2&ptO,1)Em.sMX쏤UecZt?fe|O`Ϙ@=RPyYRS!~򚫑|'l~ b˅LB)$)㓵d|J.ҭc\[c !ezcuv$oP8x3kүE.~Mtm$]NK^[g wlv,z2&6KwF"4?y@u^ OflcLP2\M$ ?yAk[(u5< 0:lvE,q}Fsn2GCב01CW3c'Z$X.Va-w.7[OSw]Nײc{9YVi{X!9ߥ?c2Oj>V1Hp{[և7;l$XhCnd] _iݽ,pX?67s9lwK=V}{P뾫DHwf.}yi?Mw1hkmpwjuwkkihfY{NGoco8_]hXKpNɃ(Gvs:Eg}χ{vD=AhҲ8 S֥j:ϖU; F64Ṹ=f1suEk~C~ʿK>h=u+-cExx1fW1oz1f6MoVS鹶X g]g)@(jdݯ׾clmk_۽/+~ilZ֓׾3_wN,mej]$lg /vChga?Vv{S*Z(}]Vn9LN dC,^Zߢo_Cv.;(slv]M }uwB;%KCasi2j%v ?ͣWCḷ N8qܻ۲?I2Q׎ǿQgj+uRƲ=|@mYv1ө})l?܋U&ܦ}s;vy2˙D lkn}f\3*=Cs|_vC,sm5m{׷;'F?Ud\̜_XW^ '@_ESf7*Mڭ[Puze[.ujXDi9a9YqR߫mN mZ=?:dHlq{Z7T{Ii>*,lP  XǵSa~ !Z*"b8!_C[ԫʬnkWa`̌+ZsPάv]Gͫޢ> `v ҹg kAPO'96?9}/#xim?Iv7 z-:%{\q4c_l{22l{/. s?ca(q}tszVK:uV>gsv׷.\][Z1s~No[u^;=68r:ܞ߫9,g+{0m=Q@$x7^5칤) 4ϑ?[VU-N{"_Y.6Hƛ?ں^7ն=X ,;+ecZbPHu<8Jyf"ȹK&5ݶ/ -AW]v֑clls3{]Tsf}u0].d\}[$EM%{tԞ4%ձsg&M#z%}斿{Efc{ufEדk>ژ lv4cPoJĻϲvG\)aN'?o}_+sEe}?mJL_u^aCY4Uk^6XZ7ܽ3p4Ẓ v/z_cl:1NPP.Me,awޯЯkqٹ;N l۰Tg'f?Tu':дxionO[eX֨g lĝO{E-pp"J|%n ݑQp p!D(/USخ%ŭ1S=R f Ԭ>N̻QM ;Yje}14b3lF羿vߠ݋;85: vڛ#Bvԙi\ps!@"~g"Z=l6Te`[:m{Ŗc\M,&GGΡ[.9!̫He>7VwS5>zൣmv{?H6%ZEr?.+_QpyԫyƗNw v95'j߫6_ܡ/ǬCqiRֳ6E^[unsX{Oslcns~;m6r; {e25ש}#eUѰqu5}3B{c+1޼ߦu|vԓ.WwZOY]Un3@ ×[fVlM͏-ٟ -Kd6 'h?&TWP;\^n嫔ׇ5;8?iT*ήkp}zm sG9=^TGt=}ռ˜?V=G*YNWO*rs@$^Yȫj,Ð, %?8^9+_k ޵z#Sb.//X9INb@KR7MyU;v!Hr] RNVR)T1qZyL1I":mg,qeTU_rwQqVn?UgzĮIIwSAP6Qws\sRh2p;S:N&ʛ0ήpYӏQ8}_c?\wUPvfmi9,f#nΊ_ NTJSdzBlE;F)1qq2LR*)-PPhotoshop 3.08BIM%8BIM:' printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXT\\NS014\ILHA02CL-1ANDARprintProofSetupObjcConfigurao de Prova proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM W8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM:8BIM08BIM-8BIM@@8BIM8BIMI WordskillsnullboundsObjcRct1Top longLeftlongBtomlongRghtlongslicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlongRghtlongurlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM kȠ Adobe_CMAdobed            k" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?5I8%A0Wf=6f0fS}ΖR9lUl mk^ƹ qcNe4Hk$pǼOIԓܔ1FڍH=Ѯ x4G2 %4w @s}pLhOMi.u RI%")05{yj<^u:;=8f0cRGguNcv,g:ݱ F2&ptO,1)Em.sMX쏤UecZt?fe|O`Ϙ@=RPyYRS!~򚫑|'l~ b˅LB)$)㓵d|J.ҭc\[c !ezcuv$oP8x3kүE.~Mtm$]NK^[g wlv,z2&6KwF"4?y@u^ OflcLP2\M$ ?yAk[(u5< 0:lvE,q}Fsn2GCב01CW3c'Z$X.Va-w.7[OSw]Nײc{9YVi{X!9ߥ?c2Oj>V1Hp{[և7;l$XhCnd] _iݽ,pX?67s9lwK=V}{P뾫DHwf.}yi?Mw1hkmpwjuwkkihfY{NGoco8_]hXKpNɃ(Gvs:Eg}χ{vD=AhҲ8 S֥j:ϖU; F64Ṹ=f1suEk~C~ʿK>h=u+-cExx1fW1oz1f6MoVS鹶X g]g)@(jdݯ׾clmk_۽/+~ilZ֓׾3_wN,mej]$lg /vChga?Vv{S*Z(}]Vn9LN dC,^Zߢo_Cv.;(slv]M }uwB;%KCasi2j%v ?ͣWCḷ N8qܻ۲?I2Q׎ǿQgj+uRƲ=|@mYv1ө})l?܋U&ܦ}s;vy2˙D lkn}f\3*=Cs|_vC,sm5m{׷;'F?Ud\̜_XW^ '@_ESf7*Mڭ[Puze[.ujXDi9a9YqR߫mN mZ=?:dHlq{Z7T{Ii>*,lP  XǵSa~ !Z*"b8!_C[ԫʬnkWa`̌+ZsPάv]Gͫޢ> `v ҹg kAPO'96?9}/#xim?Iv7 z-:%{\q4c_l{22l{/. s?ca(q}tszVK:uV>gsv׷.\][Z1s~No[u^;=68r:ܞ߫9,g+{0m=Q@$x7^5칤) 4ϑ?[VU-N{"_Y.6Hƛ?ں^7ն=X ,;+ecZbPHu<8Jyf"ȹK&5ݶ/ -AW]v֑clls3{]Tsf}u0].d\}[$EM%{tԞ4%ձsg&M#z%}斿{Efc{ufEדk>ژ lv4cPoJĻϲvG\)aN'?o}_+sEe}?mJL_u^aCY4Uk^6XZ7ܽ3p4Ẓ v/z_cl:1NPP.Me,awޯЯkqٹ;N l۰Tg'f?Tu':дxionO[eX֨g lĝO{E-pp"J|%n ݑQp p!D(/USخ%ŭ1S=R f Ԭ>N̻QM ;Yje}14b3lF羿vߠ݋;85: vڛ#Bvԙi\ps!@"~g"Z=l6Te`[:m{Ŗc\M,&GGΡ[.9!̫He>7VwS5>zൣmv{?H6%ZEr?.+_QpyԫyƗNw v95'j߫6_ܡ/ǬCqiRֳ6E^[unsX{Oslcns~;m6r; {e25ש}#eUѰqu5}3B{c+1޼ߦu|vԓ.WwZOY]Un3@ ×[fVlM͏-ٟ -Kd6 'h?&TWP;\^n嫔ׇ5;8?iT*ήkp}zm sG9=^TGt=}ռ˜?V=G*YNWO*rs@$^Yȫj,Ð, %?8^9+_k ޵z#Sb.//X9INb@KR7MyU;v!Hr] RNVR)T1qZyL1I":mg,qeTU_rwQqVn?UgzĮIIwSAP6Qws\sRh2p;S:N&ʛ0ήpYӏQ8}_c?\wUPvfmi9,f#nΊ_ NTJSdzBlE;F)1qq2LR*)-8BIM!SAdobe PhotoshopAdobe Photoshop CC8BIMhttp://ns.adobe.com/xap/1.0/ xmp.did:1a1f1216-9805-4ae0-bf09-86747e5e3afc xmp.did:77c5b0d8-0165-4c17-988d-903372ff0347 xmp.did:cc4f4346-a1a6-4ee8-9adc-bb0549cd33d5 xmp.did:f97ef552-20d8-49d0-9a6f-c1d478cadaef xmp.did:ff3229a9-9ad6-421e-9898-32e4f5814314 ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$UWf]vlP*ثbf]vlUٰb͊]XNlUثb͊6vl*ث Z.½CKPFIQL8wu}pDurJJ6I8vrfEh=&w2M\¼Pr;RAtNA }Mj3olE@Q\f f{9&"8s', hd7w-e(+ـ/tŕ:˦UJ•`ek 52T/jd"m8%qB ,W"fVς Yzu&c+Ly޹<aV)۴æC31 ]< )EE-qP qH+O YAenWN;'eKm`d 1ز㗁Wt͊Z2Vb͊6*ثb/['f͊?9ثb͊6*ثb‡f]6*ث UٱWfZ'6*6(vV(vl*ث`Wf] 6*ثb͊+;6wMr_8{yޙ7kVzޯ8yr _LP3Pji]bj9J)﫨7;4Q{ӛ_/]1DB($rص;wֳTܓ{lت{fV]vlUٰXٱWf]vlUٱvl*ثٱVlUflUٱWf]vl UٱCWf;uܳ ċPirCZHc((H۟"=" @y+E-*ւty`Z ]ێT8 r, 4ilu0ek50`e"x)ٱWeC\L &rTv.Œ8 R) و.86 n劈Ͳ8i|g# -.*82es1Zydv '|Dn~-:>eEcJdˌiRl c) <`l cdv^+n0]v:ݗ'eK) v^,Z^)o6*ثb͊6)hee⡼g 9̼UٱWeb]vVvV(vlUٱWf]v^vlUٱV͊f銻+ vlUٱWf]vlUٰ+aWf‡f®ncya(ӑ^PwH6Vb9dTub<@5#?"_󔿔^zh^^O-ݦ];9z@eِR~/2`kǡ/}Ds[;ob[V  Yc}9u/t&NOhX$;z2L{+ cO>{wF}C} O ~#aAEF!ew?s_M4y{Fۘ'_Pjx`ʂ#ԁ>e?y# G;H%)tGNޞiYӍFY/}qϲ_'緓t̿)=m/HI̻I z jH aœy}*]y#2\lJb‡f];+v^*ثavlUٱWuͅV[vlUٱWf]6vV(vlPB6*ثb͊6*ث…qbثزk6*ثb͊6*ثaf];/ ]vlUٱWf\M3byfŹZ—ebf]vj[vlPRUXٱWf]Av7.Ɯ, abaŁv0`]-er, Lj.X8]ŋCؙ]8.I퉜ZLj-\HW' Q+$CT IaK:4bG Iv$rMEؑ]6H5I!K4Ȼl!NNIbgW\aSWcv4[`[ IE8Xܐb].rVjbj`Web+bͅ]۳aWf W偋 ӲkLV㩊i|2dx`d_ x2%B{bdIm~@vXx;02nj`ZN;An<`fi>ၐv;MLSKc;6*9TBkJxb2 . mŖ:Oe}Zuq>ӛr_iR$iP?,Z5:ߕC Yn2DAZ:{TvϮ5ݽ8hXz9cHkB~G_|ws~vf~;t,ҵx׏ZT Qͧ qc"2;لwm/bxe})4YRe~-yXQn͊vlUٱWf] 6*Pثٰs`UWf®́] 6*ءXb͊ͅ6*ثb͊ '+-͊6*ثb͊6*ثbٰ͆ݕvlUٰ+aWe]\تYVk6*ثb͊۳b͊6*ثb͊/ 6*һ(H.Ɯ4Ļp^:c, xÅv&qk.-eؙŬp.X땅n/QʼnnÅlo8ZHL v&pQ\|Lᦲ DJS8i83 rv" &6H4ɬDL1#j%ؑ;l-88Zo'%MDl!E؋dDp.90ؙ8@k%ӆ ,[V(\ ro*Bw\aE;+edءv^ KVɮl4b\+nʮ(|r6,bpYc,Ze YtK]0ZiiLm4,1H \pY\~@7Ȳ1@2-,`,c[hxȶnj Xၘhc,q. 1Hn, xŘhv)[Z  W*miP.]1d"9P%`X%8,|q7X&MĦd*LE VfC KR,ˆ#/leFN\0=pRL.\1ґ5 ,2-~8 YJ㫊m,bɵnjY?'S5p&A\ hec]\RRx8vNA)v^02bxRثb͊V\UsWBU9ثWe͊+ vV*UXb͊6*ثYXٰٱWf]vlUٱWf]vlUXٰb5k]P]kIm)Ihq<9ʕhSH"܁Fxyt `">Ƕ|rrqoW1~p_/$m[eh^Q]Bs{>cxr9߭ px6΍7tj?V 464ϨZt~}CCGv6+Ww_EZk~ϗmG\æ SG!E &Eh6RUB.}쿱{3H0 25bw8}wT7'fxqm?ڕ^_W+pQt? Rb^yN6#!o[ոT ~Jˣ,pʤwǖp0YXǜy2ךosCC$lqL:ViJ>PlUٱWf]vl*ثCaV́V\Uثb͊6*ثE6(vlUٰb͊6*ثbL(YvlUٱWf]vlUٱWf] +bebeKCb͊6vl*,تkk6*ثb͊۲Cb͊6*ثb͊/KcJثaWf]vlPUӅv4x8-Z˱38.-eX+64įƜP]8XcG|Hj+鉜-E~&q`WLH 2o8Zq6&6jxSL&"IT'b-4p=.NH4IrMjHj.ĎH4ؑŪN[$dHIv4 l IĕÓ eӅ\|P*V7ZeaC|r%x8XliĻ+ -٫۳W[vQ8-٫-wmp6*cc;0S0\q ,`d.\p\Eܱp[1Lp\E}S"YKWluq`%j1d[u10-W02 Nၘp c`f2Hx\YeW^$7˾*m&v<MsŖ<|q-C74dŖ: ۣIH'&T\bS&!S!nL`,tBӊ[CTf8Y4nj d òk\SmRx\ qd 7LReR(-/]œKK0]œ%xbI[] +/ W.9ثb͊+;+ 6*UXb®͊6*تܬPءٱWf®͊6vlUٰb͊+;6vlUٱWfV N-maӮP5k$n(C+p lhF3kw5{Ghm޴>#>;Tkߗv2d'j{.s3ZĚnZ#ZJq>1kn֌%QS}Փo{LXG|Ҵ6%[K^B>'4EޚpP LS,C񗋂+T[ jiu~v,~>A!x`J&7W HaȊ6:n9[+RI%b\ۨ=O-rQ˚ Li/ln ed!GvIJ"q c LxxG ȻqX=+N5}Mts{"PʴZWsN0,8ǚC}^m\rE+T9x5B3{KlN y=~)F1yc ;Vx(P£>?D?91䆸~m׊Qz`@lP6|c_;8 }X _hc~jƙ([JiOnpK6*ثbͅ]vlP*4͊sb͊6*ثb͊+;6*BvlUٱWf]usaBrVb͊6*ثb͊6*i][ٱWf]6vlUihlUnlUٱWf]vV(vlUٱWf]vlUٰһ6**ٱKb͊6*ءٱWf]cNӋqv0`]8.aŁv0`]XPm8[, Ď8Z)ZቜQ_4]-Eؙ].liEANH5b-N$dq6HIT剜ZIAE؋dLINĎ]9&rNƜʦ(Ӳ;6.!\q$Ɯ,Jr%v\4[l([eW -UKn͍-/mx+vXx8p;@2$6nj x[@v;";8 `b-rliw.8 f"lp\--\x-T}NXgZf+n6)uo,)eV켊Z )`;V\Y5xŘ.cKdp!.t++q͊Z]vl*V͊9ثb8vV;/vV*ثWf®͊6*9UCٰ+aWfͅ]6vlUٱWebٰvlUٱUV?6+5<Ϧi?:Kt(" ivjk=ݩ dV"E?da1q܎ϕ5[8BP9([п?Oh?u-e2 z3.ƫNiC@67^Yx>& o $tˡsqP<[J?]ZZ{}!u_>G _CwAt5'_. 3e2w'#Q'QR?/!!~ak9YE%Jn?C8yZi H<>iVݚnK!?0UR50˸g됶%t7,p+?cXhfyn,H0ɧ$՛7AiT3T!_x[N?\k3}ik5^@ Vz_pF__>k[B`/'yv_rVMbq$ +3!ںXn8pDŽ@}^H]>%K Ii/ZW>g;]vl*ثCaVlUmsbf]vlUٱWf];6vlUٱWf]vl*PlUٱWf]vlUٱWf] +beaCb͊6*ٰD6*VKCbPثb͊6*i]vlUxb͊6*ثbʮ+n͊۳bf]vlUX.ƜXˌ8+ , L]8X;+8P[|iŁ+%c bG Y\13ĎLk-'juq#j+3Qv$NIEؓajሶH4v" 'b-id]6H4I؉/$rM2-G 54ĎH5IpĎ$rApS+ VRLŠnTiٱCHvQʼn]rA]'$KL v402T\,mp>9H2vjUx/2v^Lx;`cD \PdK`j-n(0 D :clZ< --ǁ%@وLm-8 m"-rp=lWLx\˾(-/(lw,xLc[lP&F\p\mbr$8("d ,xLM 2&MUh-Ak*[3Ca.(- ]w-n(06c,ñf+kˮ)`H-uqekkLH+:o,RV v8YZÏ`.^,@c,]cf ZF^)[v^5qC+bLU9ثb‡eb͊/vV*(vlRثS͊ ٱWfͅ]vlUXxUٱWebUٱWf]ZOlتث\1^Ml}yq[Yyŕ쵝= YkzBSR·vX0+9z+X4eӌG~ ~IRN(3J8P'^]>_TWS=P3jv eYr}prǙܞĵ; cc)O|emvlUٰbͅZ&UWf]vl ثٱWfͅ]v^*UٱWf«I sb͊6*ثb͊6*‹vV;6*ثb͊6*4͊lUثb\VݕvlUٱWf] 6*ثWf]vV(vl*ثWeWf]vlUզlUث\bTbr%Ɯ,Kk8X,8bg Y^:cN,Kx,8.ƜPW(8+p8ËF$pxbg Y]9&5$pbg YlI/ĎH4؋ai[iLTH4I؋ddEaN[ L-ExI-ESl!NĎI\f ]B)XPPWdӅ_rA.k%ؙ]p%mpf+mLp \ sW[o,4] ];2, 0Pd["YcDE hYan(0ج8\PdKhS 0vTT=Ȓ0[!tr  [^ؠ\"{bdmEDžm- و l,-уX12,k X;\ v8 v< v:i4ǃJT`nnj ,X8Av]p&ݚݗ\+n W\M)iၘp+زvXv%v^M ]Lx8Y2hJPYvNbY;,b;02;,blR+;6(vlRRP9̬UٰXWeb͊/ 6*ثb lU(vlPٱWf®́] uui6*Ud )+ P:u.b[CI5R-F> LoI#~$_&Ѭ/nf@EN z L\?y͇'/n8hZ8/=։r#%}~7Xtp&r=Qˆ Fqd+ς?'s#{w|%*. # p_z)s!I+W0 b|+?˽Ae.K7eIfUp˸$VdN҆ LxDEII$oi_q%}Y\\JjHfcI'xicbH-7^g%JE^h60˾xO]cRHt}h7WY50xDs;/zۈ~) 0/, .գԏs7W˟40zޣk-9*x^JƧN#;C9t8Hp/M,ccb\ KTTב~txB5/v:=Σl?$~.] a/`isfQ8w}X6;r[V-晥~W~WjWr[_X$b? zBjUb S<@HPCcc@LONV=Nu VB1_yG̒::Jǒ\+S *~:mic8?'F1 ك7wd̈́ Z0u?9o+~f~a)~R麙תOI&<LfVV4+w=ڙGC " .~Y@Gn"$8xA6w>_b~"U実hjZ"= :WgJҬMKYdd ˇsj=cA&K I'GaxD\1Ԕ`H6GMN- mXZ/UOzssKWYw|s}V݆w$R^\9bB+Ar~lx!($cV¸&k͜p~'I% RSʵ W_f?.,?}<:.A"xXzo0'Wڝ "#F`@paqށ>I~>NBT/Rk_}XTesp#SU;*{)~bq5}z}qt{5}^@-R&C;uYSoOיyV,sm3Z2rbj/,t_eX#D/:n$=H@!߹-km.;yLbBHq8=~QZojsAqOJo_Y~a (<~ړ8%D docB ]X6[d<jl[lUXٰDVf]vlUٱWf];6vlUٱWf]vj[hPZ͊6*ثb͊6vjvV;6*ثb͊/'+-͊6*mXٱWf]vl*UٱWf] +[b];6)v^*rVf W6)k/vl ثb͊6*ثb͊v0`W.4bWcf, %pË+.X&pėcËLj.ĎHj.I\H9&IIS8CL1XLXdL[$'rěiHTI\aj!v&F# Y5Å]1C a9 pr@0%v4`Ka9 ]EW'$Jr@02v&NH%xW "f4muv8YPd[0xiv]r,v8`d)v<l,Dг2%Zؠȶp3OZr%!.V[Pd[bPi*V\PnTh. lؠȶb"[bq@qluq働2[Q\ f' \6E-cŘ- 02-ت-XMqA5cŐ-S>]qM.ڦ]qM9u68 nf }1Y;X8 W\p8;Nˮp;1d0]ŐXMrd(1fcdv)v8`dœ%a뗋&KW ]+v9̬(vV*ثb͊/ 6*ثD͊͊ͅ6*ث`Wf®́]wr5?/<{BP$WRAMIf;HvvsCw8GŧS(|y'^] z 6?,?>{a_Dgh45o'8?}{䉳,d&NUqt05X4c`I 3yK-Zhh \}7Ҍlnˬ+58QhTZ/cψ̓i/Xfp srXNPcx"E#Jmdb!V'vy vEAʚiX³,֗؅ < |=5]ں(Q2 LrB#[t+|A4˝:3K1XV}L?<>Vkc!NNMQi4y;W]%c>P܋^$qmG~O1iة9"E!XSZx$ӿ41%k+u/Vk[{{o(eHYkU9-GeKE6-F+ Q#@CO%2Lb&Ӵ ๠SΟȀWi%~n~`h3,EBzU`3kfdQ2p2#[$qDMwWn5+%Q7R?UΖ󄗉6dtD &[ۅ84͔2ieLN~!N_qJv+Mf3?R~:c|D~_Yi~CN`F2F9Nӛa_Bv6ؖLvq@odyH$u\p_\ϡ]o5FSG?)?=4OȟKO*qi 壃[\R3j6e `e>ކ58#AwCa.N!/~ևLbcU1SB$(j&ڞ~{DOv5?@C ?EhӜf/rq"?,N6w/?8뺧??_5m^ny*!nmsU®:.M9? &v&e٢ohz՚A%k0W*dݜ}1e渭|vt?.eM)nP$nM~m'ۧqO1dӜ?8{PF´V֞զ}rg '6*lUٱWf]6vV(vlPUE@f2~漙c {(q)ypk˂xML{#L2FbAn)sH#ʙ] '+-͊6*ثb͊6*iͅ]vl ثaU3bsb͊+;6*ثbͅ]v^*ثb®͊6*ءٱKU͊6([]6*ءxٰ+b͊6*VݛfHfƕG 1.ƜX0`[,KXӋiʼnv&q`W8XÅv0S5ORIR!V Gb챨PX$ $XG)qw= u#TP5˒i㿖9JSWk` [&I@Ƭ'Ŧ;HQAYJ"Br<.%:SB0Fnd4;)5HُP ˳jf9\^k@@uK=ĮH Ć!Ir Mx׭+)g.Mޑ7MJWᯍ3KiEs4HIA(H = ,A1.%67a\*<5HjsO #cb,/C^9XO˧RE,(+UP(c@2KkkIieC`*$jT1ɳe16BM<fvw=YN-TaV͊͊6*ٰb͊N02@0QV4_sս{-OhˊcE=i]a~{0T" N'˻O 4<;׺rʭ~65A9_o{hF6}m *7otv$_G7z h=a8Pj0E]V!=fp&&|o ⫸́]vlUٱWf]vlUٰݕ͊6*ثbLتkk6*ح+;6*ثb®͊6*ثCaWf]6(j6*,ثUlRlUٱCb.͊6*ح64͍+bͅ]vlUٱWeXcN%p=v0`]8Åqb](X]pmd78ʩGa'Y=O'QH=G~3AādSp9LguK i{ESvk ` q&,=b;@#9Ha%lL䚊87i#j+bMMH4ɼHL.$pؙ5bG YT鉜-E#jT鉜YL4U1&MRl ,rAERL8+2{d`U:bd.W$v0 v&[$Q@5. v$[&La|<-FKƓ]ck\4.۲M0aآKlKQ hY]p&!c xYcE;,Xr$6(v>CVMo[}_z@?Kuo5KsXTIq`^,ז{g2+{̝$<3^ \evZֹּ []`zr1q~ok0ay&ǯ~wugZOi:3]vkgWCЩ͠h7uY0AgvQ]/80usU3WLHo08-P`-gLPd[5DE+h+1lHd f (,SˮVIv8 ,ݎp8d8Yx8p8v8`d زaqd 2v<`fnj [ ,ñd dv)v^,c%id/vlRثb ̼UXb] 6*ءnV*Pثb͊6*ثbͅ®]vlUkٱUWf];+ vlUٱWf] 6*(vlUiYvlUٱWf]+ ;OuwΛ'O}Cfwj`Ґ r;uD4__g}O Q>[\a^SS&(IH؎aK~0GA!yc#e 䖩5Ƭߠ#r*PW~ߎYA>"Zo!Sq d,w6C1Xt# u6s/pv90t{>&p vLrzW1*<'=drD:؃m7_49=q|]wvlUٱWfJءXPثb͊6*RV(vlUXٱWf]vl*UXWeaCb]6*V(jVbf͊6*ثb\Vݛ !Xһ/vlRثb͊6*ثb͊(a\iʼn]8Z˱iqb]8XbN7c>p.[N.fGWy"hN ,6ks;t|=3O1dtZIbmz\ez=Wi0unFe0̷ dn;-je[4>5ǮoSu Q5iՏl?&bhgz +{R6c.;?; @~=#s$[UXA'W:S0hO A̗b' ?쿳`'F>#_T+>a_ُ#_T+!>"i߇[̪txD`'aG_0;?"phف.M?f xͰbU' <5[{ كc}/|mez>6w,cDU/sIj#Jj_pS=>Y.H_cxn8w/+d6t$ƻ|iOll=QRnf=w]jO@{`7ZSlIy@|q0PpmțEb[JNñɒ/fi7ت7rm¢-&=r[M5-v$mP)Ǒn-+$_CZvB3LX=dV4L*>%sBh[˽ѩm<5ݏP0ZX,'ݳZ˟XGЌZ'~׼hjף,WIΕni7Y_}po:?Y |o&ؿ?ko:?Y |&?kb板Lg/&?kY'[H?$34˱~g[G?$34˱~⟳Mſے&vڽn}AOrCS.W}gĎnHj|`K_:[ /y5Wotp_{gwq3/䆯k>O㉶nK_kTڸ]SH_o/Ƴ'O6Oo/䆷2xq_ g%_?kbj[GrcYƉv%Wzߎ U?ݟۓ/4K~㈝:nLj֙vUW}L OQ/S?k~b0:~j?1Ze][=ԦZxl1]s}f|$j-}k7?>/8O|p'ȜLƧ w1A1=3,WGejȘ#LĚ>Ygƶ%0p%l!lj>1h^?f5K}#~8<6CQъ?Df5K}/|x5Noljb >1[G8 ~ X Φ!{Zmt^S- 84  rA2N>|&|*d)L8ip^iJ Ria7uhG')ЌYȾb&{zq9>GQ& B|x;\G ꋰ.t^>9 vANڏk; 8oޣMmг7^(~NpdS<늃mf(-Z`\K훞 Hx|dhS`\qC#T_<2\p|MS 1%,[0]0Z<Y8 k,[LC0\< _Ycaf f Yqf cd,b;1dcdv)vXŐv8 ZN;VNƗG8OǷ㆘qqx-\L ?aip2)«K\ثÚV\RlUٱWfWlثyWf]vlUixsbq†o6*:fTk,`dœb͊6*ثaWe‡eblUflUٱWf]vlU؄]Le<1K^dKEyG"/=mA5<^u:>-o]ٝ >_Xxy֥'v<0 K_ ۍD*gAR0P^yNm7 TU2c$XP $QiʚçPeŨ~s Fsqˎ~ׇI9)MA6ݤڧH<y7~RAȟ#(D3$yذ~>Ȉӗ ֒Mg^F=ek}dJ(p^ vkei-NIi!QvǼ&x9ˣ`GNM?Qԛp1h<&#Q{LLXzռ3w-Oi)_ڬ: @Ky϶Z8x"[##ߴթþ{b{)2"OjA\w4;\r9VGA]:D N]z GgsO-wRJ^)LBieOlMf (: "4iNa?P6ZdzXC9}eZxte,4阦G-% qnlP{d8ɮmB[ u8aLF"s rׁ#_8>32Mc;8'Ɇ&9 㓝i iwqJ'Y3}Nb3%8.,Iv0U12pLj-LLY-G Q]L-D.\Hmؙ+j1\\6b+ڌWb8CT`bDT<19 " `vlq%`g|4oIP ȼ `W,qg5xg|EƜ/`x,`Dfq6鉗pU9\*qɈ!8'nu,u@k%b.2N)"!a(2-#DYe_,ixm`I2r,v<`f0V!.㎮ f ӷ\/u])=K+Ο=̫ Mu=K~jVU&R֭t|q{X4ש􏲿-vXSz߽Yrzl8diTl^WӖ[kCvw=/xzN,Һ;걉dYD3ćʵݛE.!j0_(3px\nKp| ݎ 3v<6 f$ lY" cǃ0Zǃ.ǃ.ǃ0]0]@1fLx88p3v<Yup`0]@SE+M1ݎ@,v8 v:Y;,jၐZr%Mɒ Ez~T3~LV/+ vlUi=bsb͊lUp͊vlUٱWf]v^)v^vlUٱWfTY02bXٱWf]vl*UXPP4͊͊6*ثbI6hYQND.BJ$RrR6v=g߂Ǚ}8rur6" \-K[2|%`<`hSPS"f\9vwF?yڙh$w9y4ߘq+q D48|}!j92 ؘDz7y֣f?"+?;jXDǷ5?!վ^`">?cЍh ?a ËO̻;nקZ?L }&B03\[J)RV?Zy 8V 2rL!|~g*9IW4톱yJAI!>k{haL7}@HjFK4rIa}dps2iϨ]$ 0L!G܁CuN{Sv#uLw9;OږHB?Ko5F'://6^jUqV{\.'S٤Ii0ޏs_9YIGԑQLkЃlJ׮9msM4]F 4/ KZt$ґശș&#i[\-,\2XdBۨĚR.N,VKYCCb͊+ZOlUo\UٱWf]vV*Qn͊6;6*ثb͊]vlUٱWf]vlUٱCbW*6+n5\ثYWf]vl ZyRW;gCj{R@cmaЋ߹>ePԃ*G.7§=i< L|-kꉎ?LOZouvhm  9֌Wsѱ9݇-JK=YS\ ,$|IƖD4޽rq*sH]S~[Ŗdƴڵ#w CDb#ɻ wZ+w/!7 ,35ڽG]@{y#l,೽Xx ;~I+;oRmm.A]Or:=眗W.k_$^{jLzUHFFN&<'] {:hǐ뇶XP:o|H (/ wwA(Rz v ym(R^A&ecnXASRp%gNJ&XPqC'a_yR,z}5AܸAh»m❗u5/k{;Xp;G=G+#rAԱ*zS[f{Gle/@'eSSMo-~fZTԿu(N-Z3̲)p˘zLXz3$%r*Å\ 8ŬYv&p Lk*1`Ca`BqbؙĎ bLrAExAǔfk;Ls\wɈȻ\Ip8,q'UFy2y&Z"O"\ ϖȼ. ϖbeb-r`bL0yIP'"NXL#W%MdʦRHU<'Dɐ&b+ imq,tǃ,k !IYf$'m2낙q5L۱Lv:) f$p8).W"C1'c`+e'p;Lvwc a˳/6\IA^jXpG97`h]F{_!02k9-02k7:{uyK13jZײgcxgh{?"<==4DqXv%%9)͈ [׶z$GpMcj:?>G*eE= N=uv`NiЃ2Ek_ٕ֠ nT`߀@&̨a";؜p)J)ق aQUlƖ6A!ӺNcD;$6WlŞ6?qaJaz,TI$~#$FwJT׍v?1NL |YZȘ7KMhKv*Aw,gթ'>tSy[|+qެLQCݳCs ``wwgL:u8'\3Yw+BjlhWdHmv<6 ;`V Dc`X8 dKPr-Z< Zqf ccŘ*xqH.@zcŘ+hN< u8 lx8]@\0Tccmuŕ,v>-qKزp3+\Sm1$a er]m?^nbfZ&U͊LتmpqKM~kD~)€铌eIϐ?bgJǛ$||##܇uƿi6x҃3=GWef5T z^>嵿6Ӝw>~v-] 8Du.u^cçed4P Еrfg!VM؞0$ޥ)?54QXd?2Fc)B\yPj-V0 U qKe(#Z7q}1`N&V^`gnUʀ'M!~ŪJUڞ5r"<\'=FyaY5)-]N^G(B1+ӌCSO#13!W̚DEYM{y9--۸_sBAQ$W6ˡckpƕxpM?V+"I,eB-vuS];qx̆VGvxC\G/F[yIQ1SgZ߽^f7S0c^]rdžBqUU$[9րIQ5 N.YL8@@jVrzr*sWz`{G0ɪ@0~d=k] q]sRLW=GǦuO1♿{̝Zŏ^QޛižKLAI.9},XScTmQH :GbdZWN2)ݵ0V}8ǩ@̜x9t~?.Zq< C(#= 9P>.;~cB]tzlZxcU DŽKSVMNܛM9g6%Y;Zd^chAZmQ2>aOv,.4DG$6G#_=)C*z}!@ժ3C~4MM;X,Ye Ӊ>=>h,'XP̟bl45eV"@U|:Z=(Lו;+E@2~Z_%B#MF9qN9p;V̛Ρ lzKCBhGdow."Y=1U~$Sʸ2~*-*N5[sҹ 9PI4vJ k-g Yv0`[qa`BL]Li8%xKx6Ix@4NM qg5LϓƜ&9p3Ls_Yvw\I^h<).,殣e.,19`)*|LQ*:c J@1d] k4d " &\+r`e\V\QkIi# ln8I v8 v:1kX8qL<1`eŽLhYM<$'OyI=RʐRGswPhȖp6^O՗Uw> kk&XBZN8޵k]$XX㕾j~XU~Fڣ{i3ctn";ϯ,բQ5$w]QH#wmǰ0I I9 (OU_ſVrѤG'ƕ~Y۝He-]h{kf[;khԚ[b'X/4TAn)Aن}˨7q?Ѷ{J@ߒDfcg%ŔlTP0#,4]625'eM?)W-=Oz"+:淚gSFxG@ne_IwqMSY[nJ[~NkrqoŴgE֛FyFX,j>"`YT둫 D~a9ie'l/<"\7r[ڌiޕǯD/ LVro:<>lMtRXhΫ[ "~?8Ա;V_8CКm2D EW,z0;:Lm̥Ow2T ~$:5VAkz%jVP# `MB # Due"Y; Vڢʕ@O`:̓ynË%c譲پzOr$? $lG tuՁ2܉ Z;PMZA_$J L5KZ-M7BjM}8i><@CO\z.bwaң_]a1=߾|2P,w9df&?>yD߽3X5ZAĞiI9Ř2Qٌw7e& @.1q#xTZ{e>8*$rH'OD:=Rd$u$V0~}~02>)NTP<+qY%mLj8D|%`UiOO#,-oNQ>">gFuZ6VqrB;ٓ|'up `d y/'_>cm!m[e'k0kx@Yo.~pA>]g &[QBو#o,\11=>ܟZ>Md;n!͸%,skSAgw񔌞KN`j;<b$<.&҄RO`޵>#Q. H5>o|f&fwC:aTrJmskXR¹ T z1K)4d N>;uy<԰3z\ A;UWх_~]n:Q2ik!nϧ#կGdoq}bטkQ$M}ޑ4$|h_S9!dP_)1wZ_g|>¼bCt'B !ڶH+O#TBuP=[c`gN,nbkx(Uom~xF Ǩ >3#CUI\~]NAAğN@%i=P=V+7Ǚ1j\*×B<}[V c_ 1r.H#1=V?0[+,-]C+mx4~aBhwX'͍N}`xNwc%"Q%AZoB{oj":Ն۔1X%\ɒGo DN%.kϐQJJx0*Ms`jI-MWfD,rc؁ר3o%!fܬy /m5aSN7'ֻ"n3MMD >'{/f=vN"GhV=ơ'lhǷY ޕϙ{{ٝOcdJe5|ql 4Jk3Lsl`g|,;.$* +ɖȼ `g|<w\iP.wD\YYW;e8ǁYI]#ɇ`bdW%mf6eqhZd7 x\8-x'F6{iŁ N$O o畅 rE7.i-/E Mc8֑LxLv:).ݎ124  "ռii(HQ?<^_?v#7,_WM!-6|睮uzqB{pRF~{ (qH+^VbebaNX;{.:]U4P >uLL.{WŤYMu};6ϩ+[XKG{\'=]rӏx)\Fa^}m0#_>mGk?$54,oFH@orϪ;:ͫ?>]-yrS,욎[rUh*#Ս##f!Iqy`71@gEZm* XieC+ cʽH05+8VH,yVeU]{|V_Ho!8}k~a'+)Cl#i|m[0tN#!/~-tKrw?,EmSQZhZcʀЎQXUtkUg%hȪ<% wKE nQˆG En(g'|1J@>-Ox~gc+,nuREe˹_ Pjo]2Fݾms519(zSre=Ս5;Xb(U3e,Ϣd|[v}9+_&aX_[Z5WIOa$1ޠmE?*Y [/\ԆMqgO.2<_W;;z$ ׿=[J7vqjrH'+أv4 ί^O/*O|t=Z Muʧӱt?I+x-V]FzU+{3gЮdk1gPc:{R }x'{"+p夑cـQzf&H ߓ7I-S=[Icks!`:gz~U+ KxRثbͅ]vl(vV(ZOlتثc,- +Errka "z_:ͬǟgzk?QaZϜ!'"wW\1۶{od8_/ˬ73sήnu&rĎ;|ݘt- P0'x 6*ym`kӮA0&z}U#7bTxRO?1[h1E\ :)>?r ;2a Tx{a7t1Wn_+Z'BhQݩ֞Q#j8vUnyhwZVEj>"kA ݍ>Z$3cDӻv r1[zz|\jW_Bccڑ#.S߂u5q9iD "?yNk1[\zܯ_smyN ,sX!Co}ZgtSH=`cD qֿ- `RhGRw\|$|ZM:ivis2(xT3ҟy.^eྦྷz "Y~?6-O fP;~(|X-?aeBcvc֙hǷdwX0׮->9gt5Hm⧽O 4A6@ĵ+S+fj;wzq& ~_oV!9qRO '!ije$jiͪ~(474\bmkR~_2\JxƀJva%2G`#;2<`W:馄*O*Aqx߈^Pѫ^ƥIʤ/a yZѻiDZBҬ 4mNK:`Z##{xd%/WobC!C/` )}[IMed>۾t]'V2Y5My_ُAcUa6)=G}>Jv4 vLntDrָ-VCgn{?T~"b7hO|YjzCVZTVIY6biLhu@Lc_Wɴy CwJza 3gԅ=d$,3uB>ymٱCbZNlUnlUٱWf]6;6;6*UxWf]vlPإ٫Dmmsbb͊6*ثb͊6vlUٱvli]J124MnZf 91 zj{TckO@*]#^yIqMdrQikSEO;K@"WjI\H&zdzS^BI96T{ QTO;}df@yu y/ld+v?]jnTpiQ85G{\p3IoDW%% "{ON V~׹=2>_顈@Pژ>iwg==V)Rjk:>L2xUvd h& 3PO?ʉ`?hhW6$qoȢ{.FP:013pTu`ӣ- +< <;؇[wHrWDCXQyx.SjhqIm2]QO=cUmH,or8eh>=G–~1=Pzq_o)Uq3#2^AfF]Wb7bR_1=zo/Dk<^_ |< i*GP=RMRKccavO"3t*#"tڻ^&HN%\2WZ.3Osɍmf\ U 1٫ iw@UhiWLd%tih3iw TvP{vBZd^Zxp5 KCm6IJ-*(~FoׇVu+ӾTOp R(Rd-XK-Չ#u JʑRh|#aAVxo.~={[YCՇ&}…a6xe0e" og 3{A$D}نH)dRofTb, yMvgɈ8&"O"`g|sl glrVQٲrT ]Y]S3e8Ӛǁq%`b Ɠx\Θ81k'+G |F6Libg Yop]Yv0`[VbKYULIvVEr f")-cƙp9m\w,!8qW#Io[m5=[b{+i?a{-yk/)W>MqUU #>cnZ\ ݞjkԘqQiA21=zz8@>( Hbf<.x('†[ut'2{ڰTE*GM=s}1+>۝1 7c=B#a{?DI&"-KEH3a$F6$zunf|7sŔ?1yϏߪa4;T@CF?w q=8Lǐ 6O+|x@MKr D@;+74v߅]ܫ-F Y2+Ê1d 'A%]V[>%ZtE>^Gpnc$EnSe2/%M@ӟJⰥ͍G?a@> BrXO/pkrpd73,#0 bYJ'e遘=*8jS$# &f;j)o4hl]E<:@5Xq߶XcɄ}KBBTI )zOA)}P8-"?>Y55v@p:F*9#PR*3s<*£OO "CmB(V_oC +8[e܁wc'oɎQFȯ5x^- SSx-?~Gё&X2HHud*>xfsHNI铌Gf8on%# F}P6u>+oIŔE|WUq:=_˚,5d8?Q_})ڇj|˜.tgZ/I .GۜZ!ζyiuIwjrc+{,B֝LF{ճئaʃA1A3_:z~g[Ѵ>mFTr?2jpm9X}3b6*lUٱWf]]vV(vlUxٱKbeWf.&cfVf‡feaCbef] 6*PP&ƗHDLL}7; /c'ð}WL:A6{[],2לFE59.H=۰}vh|ͭ$]G:.V1) ;.r<%WvZ֔Ɯiʴ #B0w'@'!t4u4A ǧ6ʷ{.vR#&M7`U&֡>dN84ahp =<1cVH,գJi_qW*7.#%مN|3IcN,#hvc#mNb2Z~o =g%r+ $F;~LiK(d p5"{Sb!ҍAjOČI9c_S_k30v#\zhJ|585dP٤OvN[nC'DM=Ċ\ڿڐ@aY/Ϳ~I-Ua0ζ Wp7 j{a, kT-}ٓF]/oNfizFsG=-.փOCʧ, GA"ܟL?uWijsD&y ܊*f4 NF\t: cR 7ьɵ|P7[\JH5GQ^}aXFynr>jns$OZvǛϿ>aM:ђJ$u#anOs 8f ScᖘQm?^_J-wGS+h>%{G݆PiH91= \_>6z{b~ItPOs o]ypOпhv 2kiՓO6po~Cz%d` rA3,ܤHao>vgNJ P!Nh >'N9yyJd2G'=O*fO>YDzT|Y-:,7 $r8,Wfv}L{JP\pbk| yto4"CSx;Ӑќ:T4YuAoӽz:t7NT?dӳQBlz>6$Lzd#Nv 鲘LU>ӧԬoֽCG \*+ WP:}6ţSZ| Յ7߃A$7r!$2qg ;/a4ݪ dzjhj$G9|y0?d;(hnIu}OîVѼiw6*4͊&Vb͊6*(f®͊6*ثb͊(2bfQVaxXWd$8ekr2v^*ثbͅ]Wf] 6*ح\=@99d{;9V(2C0̄XA^Aq<sݽ -lI/Hx?0o5V0i# 5I={gC`*;ɚR6waRUԜ/v,e$Δ^Gsrc-=NDƊbx đxÏj:xbԩ4 m\Uws쬚9}gOO1NL}`;Lfx5+D]{}x,uκ ֠GUiXx"daIk%{1vX01cS_35B@>9CG!mO r4=LM61/ծmQ*LI^->(3sXNd<|GFDn>_\je!O)xҿu5ޤxc!(\*`,g|oNl+[l"rݘI670i!fTQcC}eHdV5ֽHP|;e߿i13Ǜ5/΢ /]Щ^O4(101B<GVy"j- AqzH7]돱\/$ *bvx4״O՛y,!`wK$%FCn>r*6z}*6|֗ɧH)b6o5RCL%")aƢP)|/윝>?/2&J^yL5TR4?fi1KO?olSd-tByH+l?Vzd9 .?[ǰ_"g~/ь FE1F|[ᜮ;!{쑈 m=Tl:wxnDB~0~9IS^o5Py÷)& zL+0qKۭ2:yFPS 1 Դ, r߹IA0ݲuyA~V3DH3؍m³@_B6?vb ߽mu?(bA@yo*Z+v OS1{Y]We<>s$tvt;ޏysz%5V@  ޿Ⱦ@ˮ͵;<æ srCY[$&`~YzŢ(h!S$׏1$둹%>9ݜaI@x[Zm`79pM"|S{($O-Wԥ[6‡ZSB9vx4']×[ 6=^K-yB),%n Jrgm oӣ,ӻfB~AJvz|NJt#i\z >3_澫N0@44@RI>8#ЎJtDkbLd,^[}[Qc6i)+8%~*nrlDѴXOueĎ YWH;(r:?ٓ`-Vx`K{&Q"zJ$G7@6琟nu+ӷ)pw`lwC,GIw)C NGJAmN.Iy z$*wʈlo~Il&emY"ZH# W*z( L"hVa,, `r֠Ҁ}4!MkvFaȕZ/."цPQSkf@a(s(TUio4͊cAh} cCbs(]ިhe4v-ve;F\.L:_Oz4خD<"&VuZ#,U0|oڋ>{ A{g ?ʉP~DW*`ʅ\#x$l)SMJeAc %:> w#}Bq_qt@[W\h_G)wcH7$q֔ F|] Tuz։Ee ɼ7t ^?j ZܽYVXGډdZt=k?kXVj:#i %g3TTrb~ޝY4ZeM Gq X~y}䛨㸑Ž²Fd'XX(*t]hcO%Mc5޴~TίMFM<}~ׯnZ1Y=cO"[y˨,[[WQ9F_˯%d3Q"NOGHv}#}9?oBqʯ}c+!KjBAG71mTPǕ}e6 l+Z ;tt;yŅL2rE,WR+ 300G_k%Jb[V*÷l@izg~ZsiĝWhTx(fn^kB`Iڕ8xs5i` j {a"  ;v8A e'cŘ-Lx8)If< ``8l S`Lx8<[Zp3i Wlx80\r,]``03nj ñlkxbVa0P`lbx؛`Av p#-6`2WebV]vlRRثbf)fͅ]v^uiV͊ͅ]]v^/6**P*؁hS'dw9vqDnqh̥p +N#zI[.{6ãKMGy %nFjOZCM# .7#e,O3srI;9.˸\YfLlR)n,'XmQ7W36?h>;nD5[qnte&01DROZdF>3|c2 Ϗ!m'H3F~ vp$e4i> zo&*µCb-rm(3?!9mA [2~`οX"!Tjx㠂u!.Grqx5)^i#"/1~$oJ!@E= D AZl< Odt2WE30 *s=%i~FhO_̨Yq2MK}"^EE>.'ht3+N|9\{_{ťo9MdNOeF@< &zl۰gMQŰފjĒĂƀԅ\_V,l<$c Ք'WXry5#DD}uvqzTIAOR_$i: T6,nj[<Cb $D3pQW5 ?q ez} $:?WT&$ ,S~Dl|7i^u{YV>(f" iP$obAzx &Bn+C`¸9mXW"ClJ;Pd[AS8Y;6*UٱWf][WbrLRf?.\Iq`o`k Mq)C=ٟYu;m2~esхع nLYIsش}Kq}V&L'{2;9;||0 b@pe j|KK*m9 N-TNI}~^Pq _&X sJޏ/sp@X,X{̵36Ċ!{v?%O6àowӼ9䤗 #'AW֐w ؟חCŊ @ηGTSԘLjc*#}oF9%IީS >]f/r~`n~쏊z1l^ޫ ˲a@~p?5o!1CHL2ѣa,b[j`~_ rޏ.*W nр~jbW`X.[a4#N[k>rĐ޳3@""<\N6CשQk'. ]鍦oF膎(Joi#[HVT}fJQ~Lqʉt7-MDK|iV3 # Bې:hPw~e/бwyvVff`J(+]XBI2'5ȉZm68 HDbGqjh7U?v)MwR;aWǹyci6?sӠ(oH"D$ҝ&!!`JRYl Wc;wA[{3[ߑ[o 4} հl#[rᗗ$L ޘ7%A[@gY8U< hu+_Ԕq`dIyLY2B4`<ȑL,g' K"I8QݯR1mf+ ƕlj.Ƒ8ZT\LQ]j+LL9&a90v&NH[90Wbd䚉]pcL5 5ck|r->9XR)@06~Ej`;嘰K)[R#d/!ZktGC@:W=[og2j=Z}{O;Fj}Z`ϝb#ٻ nre'jg݉Ηb#"^7gKc_n﮵7/ru#toH!j\%nLbXW д 4\z6ImG3_švlqd6zDs?%~oeK\b]dx@/-Asjҏ#\ >Y}MlH'k{O3#ԓhz6֌q@G2]$2[ 'g(v."[yDiN-e#2rEUM}IfCC!693XE 2[d 5{h4R;`?J@R~#xvp$ V(e ]K)R\zmS0<ěϽ s[i-^u`j]t˃Y>E|8fDQS2  Mǜ+ntjvP3{OrO cC\Ld6^`ӮS5#Qө| H*LI_0pϐ-e^6sQ& ((ʅtBPCH!`Abh~gRXx醴e4l)2S@}h.֮:D(aHM1L$R U@#6}xW(gCB,^;bFW y8WM2KkNvޣ1OcX)O'&f$G$o/iKY.яW䎎F&<$5D>=V}.ʡm$S';m{=B9Fپc6C0;7j>_&6`aqV;ҟn&H)8!=̜YO5 t &-_ȟƫ<)׉!#*բӨd|thWPձs|ipE+e;Sua9~R]@׷" yƱ 5kRAcF%9Ţ(<4vMI%H^r叾w0*: Z<d\YNkJ,#,'֖SAv (ё5ͪ$! 97}[reO@7l3}9W}CٞŎxOxg<څ]]vH oHȋJn@ lN{{XMWb֟Nqe@֞>'ʣɑ$04*?oWyBO@wdtcCoǽ-s#$f"_$t'k]Y#EJxdd~ +(hdʟR@ dQ@ؑ^WFCax-|utᵉ#F!aڣv_QK е|OeI9,1i'd76Q04a> ҋrPf-5_}.1$vJ2gM-8@ TƘgkyEԄ=Iߏz$ _I0Y&`ߊPx(}tBbrzz4I99^:,4SJFa\]8OܡW?Nx̸ZNYE;X/5=K= N1a"bi',zggmnt:"5f%Z MD # 4qNe|?'N a{R̒HcyHVt$:]n$cdW*5,Ii'/Cm$Sq+Aw׹x&{i'"{3kjg1e٥;o[ci,Q*}0՘ؓNJS2wKn4SjM@z5R4$j*5=pmP]e 5n}h_Lvjjoǝv?Nl꣒f5Gk 76u[%kWe԰Fͷ&G'­6[PڐHw^9,`>ZAˑ^ռpt)  ;=(7Z[]:T#@;u'|Y2ԭ)Jdk^[[ũI *\]pIS\E+AV4鿏dC6+n_%Ц _\]v(COD= !ի܁ڧ8s)bڣ\,ǂD8roi-hz_)d@Hҥ 5qQ #)Oa%kyzjZv-U<9qNNVsr&>?|\L~*n6$ny[fD-va ^⭣&rY~^B(I]xoas$3qH=WOm}Gs_9oN9'ofy`6|#Kx/B&}w>#b_ ~pPfܟtMI宝WZo8Gky_J̺YFJ(Һv uk3 48ںqu}o6ky;H[hƇHRWM>]sZU ıdvh;cT┉w"t5ߘMf[A*֭ KvGsO);y8P1%5 i;ԍ4T#C8;skm?NF*;iNʰ@j9~N=(e7TУz*s$)ڤmm$+7Aϸ$ט-Q%x?6uv? |+O*xzTe\{>[GnWh6hdVjlh̛UF}";ڧ c1N@Ij/?jrp~^xzfDƕ (/O?a@rIH?Z[KaPTGWj0FM:H֍+J!Yq0i|i}PAI^$xG!sd94?bA^,b{ux* ;|D|0ŴnL%OR)>}~yĐd#O>,0VWÊasB߫4ѮP7Gh4VtПu Y@-#3ۯ!"]^{vi4BbxKɕM{P@ttztcȭ$%RŅKלn{R[̭ꀬ;^c؞{z̈́}IXbJWBuhvĭ#<<;c,@MPOW Ž_ٕFlEj>Ғ6@T-XG`x^ ~ _պ2HvlXuOб{ѬƐ:wѩSque?ezm]ڃ!Jv jQz;{XJcSU`G_r;t 1)j7\2%^4= T]S|y>YѮPQ"cYj~/' W`NVI!y[ d?IƛfE% ֍O!-6A!ܷ};?Us?f4k٢Og~؀ry8Y] D?x/7lc.u{(v 1jUk)C|i'AG=ŪxgG?<|_ZGZQESЍFyj9,x5$,Ў$2c>9}S2= 'q;TMSȑة}>h\1o&jGֆC'w 4y0 !Ⱥ.#Ջ/.E焄uH2/~jf9bhu佧ؙ:\9ǣ=5T "C7ǃ.ǃ0ZdžLĖc`bNǃ6Kq@p3qf lؠ1A`\G< [`Ac,ñ0];03аuPڏRQ˨4'aؾ0w{ۙ񝻞__]lg,Nja?& ~9䝁oZ9zӹe` >3c`8*Dw,"g3UQӑr>!zVEaҝ}cߓQ86º# הGE14uG3NO]LƮ3㐔jk^~iR9.b[T=+H"C૱#nT/" _O0Pˆ6;Gk.tBq /Ʃ/zv>@qIg_I-P*X|,Xnls*ۑ>LhN< ]A~'H<$k?hg<_ɑ˘@#Jnu>-jF_o487_q" DhS Tv#LbdfVjjWTˣQ<̟1^\b n`zNM̾n:4$J}%6Y&,WjAGނiԚ-3Zr Њ?(ͥCnfxW5)dT⁶c'3m_Pkqk=3OYoJ/F!4-ED;טdgG*'9NIYbOv/cEBz|w6]yDUZܓ㿾En5#)-k&p4zGw$wCk!mkİrZo\k9̆@Idkkei8iXTV--Svi9o[yHEl v~;}dpAHe#J{' F+BB^+\-eVæJ#Z,G*rnR($[|Gvݶۧ\f]πɌ l:(1ۭ[H#JK Oev>ԍ/zyu)CՌp@W{Xb I*kC|r.3BLCfް N2:u2J8GcE'=7 v{D;~91,=r"Ƽ WP t˜aRO˰b!3tzni;Pzܑ1ۧ>\ѿK쇹+龭U-#%ɡ#`',Rj CO|ĖݲNh-kCoa"d;D}xdO}+y6@٥xnnfir!|ZhX$d҇lM0,Q Z֗,ʩ AZ6`@AotQX PHi{JA}hT"U: #]Aޜ(9 #7ێuzڑv+r5ߋF-ve$m(08-b\`6T &;G:~1 16(%7Xՙ@ZP6 F۞,(1{wŚI.Ja>h({zOuDcĕQEPw}iRV i.4 +G*CwzSEMF0ґ$fzoZirvϲdhsۗ_ɟ?#mjZpue'ӡCB+JY2[ BL15nv1ߝփR&.Nǫ@K/yڄ7 Gȣ^ƕz]fXV ޷O2EKO7Y;_cl$cf ݀2byw!# 0pmy)[nPkPW6 =o¿۔lDR+4aWNS,l XΝl3V1-]ij0 sx%3wa7@e?qbF^\zR*;vdznԇxO]].Ns%l Xoǧ!ϝ=M-ў!#>;: qλ5!ź9#&PA9$0#>[ d(" Q$L>1|i51 eL Dq# 2+2ra@;bG$d bG&$rMEpg$]'$nWqÒk-i9&!nƜ[ ㍮cmӶnX8WIv .Fo;ٽOjC IΫ2 xb}SkVRn|9~8QA+:2j}fK{#\2jr"zg7:uhFs ni$nR5Iz 4pF"}"#@r2!!$Mq|"w'f\qiŵn'ۯ_㗌n@"ӫ _m NG廖dVy$h11"8HO@h{XK$g.?y? xǷ@|M֬gG۟xȒ?Gs^v| ~f~\H~yyu-h6i['`V=! kO]iycQXZeJB *NbPv8m p.OnFF6-Q\[h܃"Cr=,KƐ$^ %~`|UܗZ{cDsFgK0*P|TǦiR?xRzx3p;lǜvy'V{p,e%P*%EQ~Y:Ҹ Ct_>[%hݒ}Œ[o@(opG&E?@1v#ԖI^Q^jv`Nk}ƍ ?^eoe[CXsvWZ3HH 7+QwbF-n%T?ۍ 9U^b!:CѩsEciIuK A%IJ ``{㹖(kO%wϕ泼pebaŭFyՌ MiYG^=E1W b1- 2uhc ĖEiq:npD  *OE'Ďd2qڥBO4F @CUWg~"+{G;lvYRƍ[gwzpq}IZkq +S5nf;K2u<\:k5be/~h+@?Tx#kD&}{Rvw#|]鯣bjߣ_FdoY$\HUT_fq,dsinj`&Pch~(xE'C֧'b=9p"Gk#NX.i~j{N$ 4n@X7쟉vcGsu`iWdn{Xg7-ޓs.{E +8,(%PQoK {7Fõlx" CS*z5mHPQzWpd-L6T֫Pn`A ah?Z=7Cy5yc"毛,eIvE0kpK[8>iB1~lEZ:"!it>Q}ُph?@y 8C7J}Y[OFsm o~d(G$f-6MX E y[Sup.JKя @]{0 CM\W`\9Awý;XUЃf(`5107*;g?4Cޏ3}2C?n 3dZo䷤7?kv;;oڸtaPAϝWsnC4H# ^&F3C8CA 5n8( ǃ-SE@p6UNؗbhh" 0Zǃf @qlp=@p6,hb`Y0T`-lVP`l c,ñE"[C040Ho\,W.! LsLVŕ-T[nVb͊/f.͊/ 6*ثD6*تx[uV:6(Z|3bf!'fA4 nz`+譁~/ OjpOGCھl$:mCRRFEni'ⴭ3{m7g))6O OGj>`U%"?0-@@NYߟFd;55-? ΡH L: t_`ϪMD$f?i{^z< *Gz 6SM /Hn$Q ҙ'f;\Z;oOGׄ ;¤x +ݹy4$MJ)w-l m4NMCOi梁t@>܏o)Ֆjև 4Aē1uG9ӊ6fshSb?XXcm9wf~)Vv9g $JCuH y S^JA;o+1A=QQig HE ƛ >t݂!R˥2ȒmII*>];aݰImCR(M*`5X&|_lHɠ4.#nSxیas p:BӵصV`9iMlw/ONuis)%57*Ec R'@Oo~msU߰oҼZ\8< #N*rr}C Ot26@ŽV:wLC2E5=EOl9;eSs1JfӇ`?ZDs![;ƔZ,r";ӕŗP:`Փc\jZy8Tr'lLd`d-1L UpCbrLm4|pRzdL-,g1yY|q'26,.;br6 *#m{pS`Kbb2ΐNss])p.]ڸqi%u==KA\#Ototzλ/m2g<8}#aĻYk @Ҿ# .T-dv{DtcF//fc"7O~u/ vP@?FLD H@7i ,xt!&=NY`4;sȃI)m"GRrCo RMnOa ]r~6Y9+X \ڞˋJ¢耞%ړ Ԩzʵ!{F [8VB9-vn2'tt.q˫Po킍ƾ݀P9l2 +c~s+'!³۪K}3+w&AcRש' $ ̨lm+R\r4 OZ5bGo yorsdJnA!)v^~v8OU]Ihc2@2V!M|U߸4"^BZW`vRQbYaϏf;e˱PE>DWs&7f\I6;uKjX :n GrG9Dv3${Y_ys5jc4YpG((25e"1=ۧqdb{U1OO`cY[b K"2{i™m(~z {WfZsKP jr\ש,+R@Jnyf%> w7e!n?Ğ*"|lGW׼p޵ɵWŖz.-lJ' z, kPj50 D *`ؑ֬:S=hLw@΍AcOn-#)qͅ {ȧ["JʉR72h~x zTm#[zb2N'mB'Y%Gmx+ /5 <`NgG$elq7z5{i ^IH>WROlkUXlm׹q@5)I1+&x `y&|`儱r,~QΑ?pmo/-~&ljŀ7ي$-)د+5[Q"L ojuWH҂FzfȄR"xQH;q;nC|vwErA'FJ YC ƀԔ!o[">D <c @HQy}"q-жm A7,~ㅢe#2a!46QW.#}oY2JW_u'qN9N՟nmIMՄꀆ0L%UكS#Lq[7+rj ~"dy=K󭗚6>KcI~>ؤ enuS;d#g]{ xFn,ANlub87zlU[vt؃MM^,N*(SĘ*ASi0%>Jձ6xoO|Ž؉7%|HV m]ې=|pKY]cۑC.͓e!L-bFA"Ġ>צb#e^Ы%,:<\ sB?[?(?9Ǒ5S61H/9`y5%B[p ͆J$4$"pz$Qfy/}9{놖#qm w7hRmHc'i#yxTE/=:^09= AEeiŕ#OьgxH>Oˏ?yO'3i$hx$e j~ЦrK$˷:irLb`TA'I~?J*áS:0`#R0߄S1&>)Dwכ僵515} =ikY /eއ`"e慳pj￶zHK۝;!zx<$3ؑZ 7ǔRiFK?5^@"N~wٝ/kÃQ|Giv6|xr"{-Zߑ>nWI:%anX}C3 7+%"[|Ntp2-f( _2CPqqRд Ph+qU8Ļ" Ap6ؠŰ- [Tnj0Z#h+qAv( l] maibh[ ؠŰ;p-#B _ib lU͊6*إٱWe]]vlUٱU6*lUٱWeaAvlPثYWf;trf۳;?hKIpuI,N pxdvXg`x7LzjO:>e^/ý͐b{65;ϟfK!}P#k),ORw·V;OWyS{:l4;屋2wj]eʜE cZH N AL-ZmʟYmM0ޕq4;Z 3˸ǔU=l@R*AP_|0HO}cc/zG/3KǡY5.5(M=zW9[(bf?$}S*Rɤis+,J8Ў`*f$K;hʗޅcOf@ߚ E< FmcQ%A#R){ uܜOM1S^LDžN\Gq'4!O̚"WW-ENKQZE5_^o( qa%YpAsABRACrwr*|0Uf6 ۝#3vq!uYhLtऎ^f"CZ҃x͎)iח NIaF%PwaZM+\NG,rxR REiU3sݼ1ߦ뻷F;EUOJx(Ci>^-.1s#pֵv5xӥ7IMS7߯>{8~!H-mh2uGS *PN[6Le-K$fx{x{bgcf#Yu }dG5u4=|7jK )n6#>_63 ղiZWiZKA$\P ZBrִO@:s2Raԏ\)⤾K4oKzP 4fOߥ2B6rH4D s8ˀt,<"ڄ[MdSĂz"p6R-XҢ!ܞ:I;r$VAZ6" BD[ %uXS[Ӷ&DM Nt$/ 4rޞBH tJm׵0㙎ˁ̟YЯ!P t:5;$u|}'ȥߖ:טaiUV*#u-"o/S,Rں h2Ri1[yJ+B@Of#õ\yc-#(%=&|r % ;ScfsqCbTvG?1T㑈C-%:cp)ӕ bzmɥt[U`w)kAȕc?w;w>Sqw#~2y\dظ#cDZ/O!!Yi3q|hTx]V2ǯ.yֻH젷Ӵ1 E'WN'`2{jX|ЗruBv w;Gwè>22Hebˎz$JQ* *<@Q۸ Lh,=zw3 FɗX1` *{z(Oo-$GtTĂ哔ޜcq2rG۳\iAڻ`w(~mLMv\W|xxv䑰ݑM!NNf1g݋G+'É|CW$vgPJŅIv}9 UT=iJzSu#e}@X68wuqi}?}dJQf7*qRGݞk֬Ig* ,ÉV9iC=Zϙ~\G*D2R~dv A߶f2J4*8) Jr9]zw?l)A$Vb*xeFlQַgo 0j!!FHm)JvN67w4[c rӶ =(6c7Zf1^ӾS,Le өāI p BǛFL"bIhKG\ Ň/+,#o=^8a?'ν柴.x3?&CK+\Ni {i*Two~dd.cQR=_HIO\9'9@Ò`J>>UڄO7sGUڤd~sGּaTVGfϢ 'dGw<ߧ='G]}kaȥΦ:c\1ݽJ $\)cԑG G9m j_Z$w{8aIt iSzo$E(XJ5= MڸZrfhϔ{ן/+W:p֡xGBw ;gf_7da^9ٍFC1ufZgn|oZ5/cz}jӰe8 a_P;mS<|&1-Ǡ7cƒF13Bw=j~]!fvCkxX, `{inS8/Ne25 ܏Z&~zV9; T% )%671N4ZC'3.:/-JJҮ&6[H4GJaC02rBW}OXEa/ Ğ=BWf*ImdL^6 }ND۠`]w&ro1 FL{mFJDPr.4ۧ»\iփ q3 GV!n!@ص4& ǽvP,<;ѤMG*oSn;|냣3ֆFQ rEխ2RX0bfbkP0H[vahг9F8U*GƀpFIڦ9Lze8&Vw,9;PӡkW,OjS'G#/s~1wە . Y|u@ i2nBm2ѯp=A2m /ɨ(~fF@?c r YoKӏE !qAiġt_#ʱHje i2u .٭ h(MVwZ8%;v8:P^-E?< E,-g%X'杉ZuZ5DQ'*{Wovgz.A]N13x>ӘSzʩ#7qO"BY+%I:]\TQ,٪=rG kDJ&Б^_o$\{yyݬUITT#q٣ րէU4҆ry*}؟eĞg6HQ},R5`=; w?2Eg{ %Op{{Ϲmy.ioQ%Rj6,H_]OzK9v W'&l0Vp_Lr"WӒ_Kcj>]Glߋ8r/3'iVK5ͯ1OQ'T rm=ɸzw{9-ZY]:`h CSTr7SѺVBDqNDwq\["5.'}OPf$u霿\\R5x'P($Ru15Z.+ם!1Ϸ($g|5՜Q_Y;%ŵ8H ۰ȗ卽ߖ54KR8I<ۯsy#\ ngP2G{?w3ɳn+I+\ ԊOQR6|'4y<>\hiS잾{!q#>ߐgd-D,cw?-9yo.AŦsm+$fR10*X08~c>s%+" |O{ev̉1O2c=|^"13=_H?/-Gyv[.. lUF;%ƞa;Q1 Sj4 ~OVY1Hn,{1ڥ IykE"7oZwW;s揶f"2bݳ xB?Jsݱ+]IwZQFFƋ T ?v$<#_fhd@̎^_;@*kڸ~3Ϥ+b93C 9[ƛhb" Tbq@qlq[p=A`+AEi=UU[PbqAl xbPd[0ka ]Į\XX._;b嗊6(vlUٱWf]vV*ثb͊M3b3b͊6vV,ZlU تӍf *ƃ2t~Sˣy?h>`ggK2:Pڍeܚ")o(ɦ@:ŸBO6CEB~/<թIsyTzĩ*ITwStF.!=7 !2D@'Oww6Op}O4Ghjҁƅ;׊ݛsmOqۙL X՗KDqĞlԁONy_ @|ѕ~i并Sq Z$5Co!^ӭpi%IM Jo>8WV9 ?[+kk Y$Im=kN# =Rc%H:z[Ƕ[?h7!YQZ5{uD!T|%A?h[F6QP=e3=U㰠$ i%ܬn"Wt6 _-V\Stbƒ5 417Pԩ4uCQOF1:W1^Adž_DbA}VmA:ZmMfYUc_Ɲ?^V}GtdzyhMEtW4]O9n}mJ 8D|*)Z( ;oߏ^Z/>r\9V=iF{* !݁;ֽpo.[0 >i֯] ո[JYH#ܕ: ؉evcZ/`|Ib e՜@_m ܇б=YbWQOq? ڪ#^V($>8~D]hF%q 2JEE CCEPT@{Wy-!ڣڥHQK(r5Q(<0nX;6ˑ!].zח./fbP-#? r6E㻞Raxi&,}r|lu&zӴ2]t28W _;/mZ*5P??S0%mͺDy^ynkOXOS/وlÓVh|$SO R9m!#lw0W>Tqԭ y4s4F0k8@y@nt2mOq$!nl9(A؎~L\= B>Doiw>_N3ǝ1^cMKSo,+rΓ$}{SӾBsڛ#dF nU <TԦk+۶ΰ`zQaIY=ڹcO9ޠ R*'?X{ =Y ߃}#䊶CKI`)B?!qu11'ۼ1CdK*()L:aH-ҧѕK16ژiʛg ΝN+o@pk9YŎ^e V {wٝ7k@QoP뵽U-Kv+CӶz7ߜڙK-lc>W&#O~Kf_FhPOl xKK# 1#b)289b3&c x<hİ(#dK 61 4sbWvQ4CdE9eHT!S&X{-Oj<}27m[{OJtOpn3^7K?<)>ͮ34;'e5K ~Ÿ> GE,{`Wbv*q?@xT6O t?c<֞[rI.cck~q=ӕ؃9;N㧻aŞT@8=̩DoShmiNuv 03CMR*q8ynmIF<|3^7;lG=#?2^/?Dzi^]g6같oLSq_4u}{K4=Nk2$Db4;a O-5 )ooaMǏ9C'r<3z,FmZB^\ų#hӱAߓ`K3j2owyFY"QJFFz`Z=`h٥>Ol1n.IM+[X;~ʒ7ߩ=2oi1 H'27ɬ>{lVA䝽nPG-1q%rE*[4tze2ǰg Ӹ~;Rb Wh qqP &a-ʿTrC/AZT 7Go@ys5iV# I'L'z4HUT"G;sޤ|[{S,4,pQa FGM+&V]z13'OWǏ'˦ڨ0 YT~5Yԡ+0 mӟ&z'HZH ;H >m^<*wI9;M}G"50=S܍a|[p J+M~Mq*c~sAD'ho\`>>ԙ91ϮZ'fo&ּsu{d֌]~9(ڵG/ACM%lgA6wižJB*:R1˰zqd! mUةQ_#2H"4*ac^ܿJD7EZ&IM7$Wiqԑj+E=C ^\L,mBIk(zW#v8qXٹ$Е|rc'nŧIw?B9]TUE/`b?w j(St8=ovCQ <,)휯Jdx!>~Nٳ0>efL,H=JRPKn@;sXYGi\7ĎH4xĘ&L 1"rb-2;Dj%x2md7P28 w,LȜ%cH\k>gc'pMiAu~dv?>vqƇY_61yL^g׼wU!?W}>[ZNS$s!>O^GؠJCĝneڧ/u}8]ms~\\xEhXNxGˡs"8D NԨ{X)Llo2#0doMs"ۣGmMkνE= f屃dcI61/x-4 Psg^ATu?Gs3[ݣ 39|WCnb\y7GSe|a1)#nk`I'`9(: Y=N5yeN{=M}xhv3~yn9<\:?9?<6M'B 5Xl([z֕GK[5Q|Ԓ~|(:ɔrp2  %\,`}['b)bT n۰Ы[?B 5g4&X6VV-2;p%[)pd 3~s?ǽoxh$YDO`@U-Dr:R?EA՘c`mz%kTl8D:tƸm#vU>)$(MKDYY..8vG_u%Y]َNLO QvH5Ee-D'?{7w2G+S+"8f1y{KvYH.n,Ѥ{$ 5~zЏ[Ms<*6ڝj* (Τwe-۠ r!a]t1q咞{:,Htˢ!x%Y0QOPߏï!=50`(HY?4rچxBl`|C?o| YZe6'd iR>qd#j+}qqdj1<1ڔ1O/(bN~v~}8r%^g|b%tX(8戜yH>/!ȋ~Zmd#YcqЫAGxVNcSAhwyci0J.,0Ro(&"zɉxΟlCҙ,n9O:žpex Wj:l28qv~ar_CT5*==Y"W3}Z[Gq1"G@<3e~1c/y^*ڋXK=պmfݝ۾@63=Zq5C[]Yǣܴ1C5"- o 独@r--qAŴf [Gh zbh^1A,&ȶUp6بnj A`v(06c)v~Cp?a`?`3bPf]+Yv^*4ثbeb®͊6*تkk+ vlP,تt9 DYc)*o" !z;Ryl{[D cT%ݬrzȼGAOsABZ+Mp~2:|h2<;S=˾^(DVHA՘{{(]B @e%e{s \lz۽&Kll.5Fc1Mu!׃rtO|Jw˓+M⼥tKtFg@4q;@C,;oe]xOO1kXn&w댹ii쬱7vy;pJǤ|}L~:F xcӡ#XOP'_V"m\1>crcg>sԾM\:j\ݛTc8-E+2ˣg/N) ]:؄2wfw5`M}+hZɸRQqVa] ;%{߭yG>m.TY'*J4r`?%WMM/MֺcU) FCGD6Cyϸ埕uu{Oh(LQNXra;!cX9E˼wźe K%ZqU]'&m2LŸw}@ܒƤxc26c;rĕmǾ a[$uW4Q;Mo k|R2"BX9RGC̫oC_'LnZ>'b*NYlC6%LK !tq1lR.wGѓ_-jm5@¹sowx揖cɍ£iN;3ELJɘW/':26I;H2P;|TذFci/} @=*>^♏!Rum,zG*i5U^r roJ1 TEs N=vǮzfv&-j"Yu?쏰?fzx*Ls>g Np\!a2:ұ EpEMl:DGp2'<:JgO\4U,lLR4 bnNVq).lh%lXShIo]UFcdE˧hF=oxcLObFΕ S C%zLv?z.߁"#3c6-PQjM Ġ=sͽ'8 [;$>n^/[y4Նiy+G/'z`N.9!ևg_zƱK[Ҙ nA%@tV גi|He&r"~)Dܺ:$O'2QP]\^OV+զ"DO@H}ϏVhx{GlUuC%(?Ge]Kc5G-ɧVoo :TlǓE)9h(cPwqH뺃睋KK}({!? ccGs>lyG˫l f!Ha8KyFcbZ՚&!r~a3}Ayfx=9ni4o {UZ~9 AysN$>9P\FGV5 UTԐz׾$`ҝxڸwsfE% %܊yU$Wqҕ!f-"ڸw#kakcU`:lza%̊q/iޙ=̫<,]:`7!ȵ]Bȉ4ol j )fXއA?P `HTZ59v_@1XëjMry%/썸J .9DS}!+XV2}z|0$яOdiiޒQP)COl]Q**R>;c*W}ʔ1Ii#s/K/~OtA*ѥ!} "`g>w'2t~Mӕ!0<:R4d%:pE̍rv'fjfʄCLOpDF};ͭѷ&cКm1;ێ7!״lfUzo@aRp[a &.Co-MŽⲩe$Et#޴V~Yc2!_$q\[^(1Á0B9xn*8ِli7 ޝAHe+euRbcH}cf5 OC1C\(hOOV2y8"Nfw`$6&UrІ>?!*b`vCoU>e$pzj:^/0Z5d+oUo8ݸ#:\=[8 3cn5HLx|^p[cqeS,`U2R<\}w,9>lK}C9 m` Wx8 mN'F˲#=n>d/{)]qw?<\|b9A;|v,pE*ݛWlU| )0T{SZbl]!a\ @#}S;]E>ef6Ɛ2\uPB[-v#$OwQId@n\Oe^Y} 7D1ۭ7}o޹G= G =NVUq;K=G9vs'hV}đt;kr?#QP"G{hٚ(U ҝ~FMrL6wWoz}DϽ󭆙mAjaAzmS. R)fbY^w39;lwүԬ!FV,Q0Hyt e @P|]zџRH _P0f ƕ) FԻFsIF""w?/ح{syp;VQIux|jy>"Gܱ=[ ~ҋ7jŞpO oa?#]tllUy SǩBD8+yIWϘE.(6Y<صөn4`m㏑/өfa=p Iވ8Q?\`ѶJT+׋ni&^MzP]dc2__m/l ;$mu'PC/$XŽy?'.AeUOCud8RIJ%-?-Y Bjpkv7 aACJz ;+FSsI _31ث(X5d_ybWGn޸1@h$|A,"N'؃JhՐ<}x NyDJ`>`ֿF^'ajGC%[+|\ DsR7#UGt߯|*mwaTOeF6Xx9Y0m_޾g*vS .A#] |]}8\ƫ4G"4g1cUbבLCQWpj׶dHqn\camd>Her^^ ЩT>4pA.N͐Hi$oarF{!Px‡#[# <5V;>H`{ Ϫd:p9{o^2^RcOӅۃǯ`"kΓ<͙YYj2cډ~wffPI$¸Sͩƛ ob331Jo`2]k!+$xr5e䡜PVc$j%y%H+H]3U @Nu߿qW$줇BOQPW`8(aϭ~oQ Ktob85qR> 2欴q#>>xPWVC$勫`6^In1TZ}dL/a<{%oKRV=B&5|"gX( AvYH ROӤmn+I =2T7((Sjv-n=EVVoO+ˠWhQͤ$@U]EGC#G7ZBu#~ߡyOK 8ڟiM|:?T|uemvy$g"#XP|G9};C1/ pZݕ$T`Dž% eR A,<Ԉ"cOT@(+C1'ǜ+?;7&o,SRs4i#oQ8LA,jYKuK N܅(gd9 ~)"t˻O2SzHvNxyƗaqr{ e9(K]FNYe<Ixfc'|{I5z#V kN+[!qّW#{cjfCFWe-8I){bZ'գ[u?dH<j1Q94FO|}#קo54xFY. jO!>j+[0t"=Y>fbGi = ;Dk " ؠƛh T`mTd[C`8q@pSh-b`.-v*2-ؠ'2%,nj ñA`v(06ca+lR[bW.,g`3bV\iإxb]v^vlUٱVlUfV4NlP͊ML5B* -WjʱR{Ohܑ`ֲ,Fa%Ơl g?wŖ!T{*l3jC;[yTnF<9p 6y3#٘5$I%!*qocZme#O3 L!,̆ژ[, y0^GĖ[O!|/i8Li6|Oգ,ǔ9jkQl1UV} TAem'nrى#yV]r5c~C} f?=O-w~b՛/4ފ+2ɕT;VcNv/ش~QyΚ3j!o+1?@ 5An2-N5+SSK1._{`Kyb-‚d~$(z%8FwoCr,Lj{'e+gTI\sXaM/nvɒB߲ ;"P>[sHȎGt[VQ[[Z&?8PyM#ۑ>Zy%9z+_OWӚ[uBs"EBAާ°m"OZ^t݄O 5 )dU$( Mc2# E%MkBW(cԽBWg(X/^%qvd43[~tZVy~ K#]k1x uO8`r/J?&&& )^uƨpArmZ>%M a+ʨڤIeR);3b8]HT:Hk?@zIdi$IS' 0;"h{ D)V<ɒiD sbƛ@dx{yr#Yu=@ڻZ`  mfKeLmv2=?a:Iu ԭ.Vk ̛QV9w-gjPI(S;ˑ b~1m4j7j rݮ'T.}1wCٌE6a'"hR qr"L 7;M$0ߋ1y]H$ђ{DMX"vVk2" )Asl99ymꝰnw|_MƽvmrIW,ZWU 䝳ά=<~g1a{Au PPl>COpb7 #"녗.V*@(z` jznd`b +\+\-zd *YZHMڟ$aCGRzaR]wXq5*6BW~ۊFЏ^ujԥM@4$4@؜4XEE=eZOpBRᅬ7Q&S1b]ۼ”>4Ɍ iSkv`zŹB=pFJn}6ǡ!n4y؇̪ qeV ůAif5NDޕ؅Ue2p|{_2O Ʉ/O^O.b6C0yoriM/k }dJ:|w>?0˹Sڜw{֗@'ͱo\ڄ=;ı,K{Nw4B;t]X"#S?!mh#SOstq9S9}9dc-1O<>* w=1bڽ0/kcȜl)(*oH{d=9{N+Lz1% XmWMBcK414`ԽN:j8́^-5' q @i$ew\?=5M U&ځw2|3oi }]{47q|\66+N<n;/> Qp5G,mS^#3H\,F~ ?aVD_q_~O)1x7?3٭e0 o-w'|=.8}TFZ9$iK;&42c ?7YSl܊bL@YSm9`#$ZwCŸt!v8d|v([<~l@-hHdbÊO>,ç56RۦU8qN<un$H-8,v\"4PBҧn/j29s$im@E|?yQDno/X$Jgq߰aYّ¦/OaN&N`DӶ.>Q[ ڊ%$47vxqGѥ$I3I)f݉=ݿ~M)-#3mbrϧ"BDI." 1ʵlI,rO#f\#BY(J_[ȉJ&?}Nu/*i)bvۧ?Ndb7/d|P,v,YW$k@d6XYRi"(Hܜea-sW#ח]yR_3_Mjo[(>)£95˩w;})xr2L-#J2i2Ĥ7۶ b S~9|e[hU]X4̒UOo6}'f~G/@4[ayH%<)˿MĀnS jZѰ~ڀo NN]vy)Hc,=>r _R?2[6a"[5ܫ6Gc4&B0޽q;ӯ3LkmhBGUC„Sdlٛy Fi4dkM_#KP<޻kdfq#1C6\,+z{)dӧdTkJe k_rLV M[R"?42BAa]y]#=dMʙ} N;&`A (=BK᪼\F= my$TZ5b)߷㐈"UocqOGK.MPb0:`h.T+dP"I9p+v WdJ uot%O%t1ߛ ǁ>/0}6)uPeIZa+JYG7[5f;11$x%X4$N9GʊOG6Qe>XyXO?ʭJPEpX9P )۩;f Yh_S['sHM z oi q? w_ d;oAAB. i>)$, jv5>xbVtL=$r.)אvUYV޼=8HOs6a,ב٘Ѳ?\Rr˭,,b<@1?p>GP9*x?q<S9(\ % l?e:c_VH^ڢYdU2GaEWpT?g'(n%,/$$@ }W ܲ.1/R˶ OؤOH䞜/lyW29 Ǭ]k#Ƶ T)_Dx+ Eҡ&8$y⼌K' ׌uIkFGHcu͏꿗 yZ-*!QJ|>'2#R4?i0O`qo9+~yb:b6q;Wt[.W&z6%@kJvd%[ϟ^ / ‡¹?W`Cx}9#( W3DcJ*$Tc;Ӯ *[uk;=˭n 7D#H}h^ERhH$NJMYVf-8m eP+Jj.@nՈ~g![1鿗j.X.Ҫצrʭff<]lBX jN9#փvc=` c _Kunܢvx߶x=ƟN~c|ʭI "G b $g>޻e26޸qm|˱?Hyh+$VZ0&}lƖZN47lg6e:"c)WeGzӮxWb3-a$zoupO E=+N @RWv8sȇK]Z?x>(Xɋ@g}e6dY;W>j4c@nkC,G#s[!V]V%ԧ^Іx\2jBV26$` *vǃL h\I` 1EM.#[ hwCAm |JİX^;Z2zgY> Xv')%VZHSG_li-Z9֮xsUJ ֞x+'~hx򜇧rwXtѬpu+e ҋsSXpʫq[(GHw̑9yre/y44i%R~+QA;lT Ne}YĚ06OZ:_y#yrBcقE.xcalK $Ԏ{3 Pz[c[/7s;tn{֝Lۉ' pQʴ1bjFb5q>l5wXQjlJ'brͳ&_] o(yI>#AO7r9k-kvn{zTxF$C(%LcOHS#Ae.dr֧/6I薎a^" /mPI0Z$#\q=}?rjMd+^WOFԇbr5ixC$@aS14vA7`9#_`N6 &94s1ӿ?!tXeYn!dܖ=?=ND{o3[{Ɂh`"J=N,gFYr1>Q%{ ėTKAd}Mڠ{x鋉/'5!ʽ&=baŻ!BG +R ۷\7Wu[w 6v`Lry|åYZdZQ,Ȍdr›Ylv0_t]J u>%O^gG/φR#0o;[$DHԯh!#z|U;^ΰTQ-4_nTACkԾoU?O꒶{p+ >&sߵ2K>-ב_2$6-))3t#|X`Jmփ bQ |JxOݒ -¾ OUͣ$%<#E  EE,(GCY>¹ ,e%Ħ**$_bx> )*@ Lld{k򬡠U;}Fóu\: t=O?TB>.-|I(z29Zv>zMd4yXY̯_LM:UO^ GQԿs:MDp4j׃}%81ڦR}[..kmp88`~cA$,gg:MGDy _(&{S4%os}zJ')%1\;2p՚z{sۘ`j^E^n6@pv .kcK ~rŐ'ך{ff]/ffTpzr~:D(]zQcn*}kfEZ WDƮ?<@Е&02 idQ~̀d1F &Tϥ7?FxGW))LiZqw<dX\'ş~qɥA@Z"lqOA]:҈/'j)a<3#=u?^hpNq3!%~@֘C<_WenL~on 3$(w;3w3k;sCYD D7JGS2uBI%|zm< g9&\ݴ_RAڃ`%iG{aΙnm) qdkp<۪%WBjqxIZi75T]ZfyzN۰24*ozV'zsM$2HǂQE5LVtfb>)Y0bDOwy#kYI\LP¦~_^mjsXڤ)=ٶʡ@}d8Nu y cjsҹ䷥d*X׏~#Am;GW@X҅6<0K  `2p)8eUü˧'ac+N8Ҁ6bo4Yunjh~:N,%V>ƻ~2@<$@lξƯag$kPVqo8h)ѕ ~ap}fӏ(F Iػ(|G&՚Fm>Tosz O&vm:a0H4 #qFBӝjG=? n#ooՖDsn>}R?y]TW%Ž{)nQeH Apn08n!u P')pnV #wyw -1cb~U_q/=qtIE?^@в>LM[5dkI+ݡ4;{ JJ#zodH9 /zrI+4;R=ӒU<:Լ't#dEn-kvAx72C^g2%e1LvRZs HFU$-^Gls2Zo<&e2[CL%G XZʾэCU iĩi;ӮAZ2WRE8yJV.\nU_ i$( Ǥ>f6Ąa %aͬ'LPjHA2Eoz6Q,m& jMmC+Q.~LFޗH$ RižhG|$>{?dO(sG-۰|3wM׺?;|g.sݏb_ꗦ=> }?p|rxg1>n\6Ē ھ=Rw>װ(wgKZY~R ]ၚhcĪAZǤ(iq X`+Wj8Zi 2'sMNdC|`ɭtޛd~S2#EXQ%ѡ.6 :` nRtb[SI);pG :bF_'|Qk'Z!X.N|jno)"2/*U+zz vQ d`.>Wye6HbHҽs^aqV%H;oȋGp>$ȹ١c_kQcII%t$ـ0{Ss >JUw"ø(yL4hHn (H-ɢ/Uh7~^4Lҳ]do뉖ah@怰USҧ"@Ջߥk~9T1vg0=N(W:{hkeeb% w6DyvQIg-=Jba+x*n{(kƜW@'?+1Nz$SyG/$g*iI)#vL(@>j(K='2GS-Д>~J&Q)6e\epss.4 pI SWbwF?ȽXCٯ+<#{VrL?z+QkjOGJ=(ES\~-LsMqPNŨ&`L@Owi.֚DgbèP:=%%ępHےr[+O-Qm!* 1U%G@#ɏAR*7 T"=NY i>??_^b'i UP|Lg;Gjj32ꣳFLlk:l@28^22;*)Qb;o`b{@XrokXx{e=W˾[3G b3GUI(ܳKhFD zX|^Jg`J?v@POO5r;5<]nUsSGˆ;p> # J?h)tkBh%0 =2!䶬qnX /}fGFkC1q T@]h֛dZ_;MɄsuXOa^ȑMS eKך s'~W $Iw?& G-5b[Bb)C̅ՙ 1ysrU">?NCLڻ3ɖnL1h۟8fcJl%JRiHAoY>rDFͣp|zنaa$΁#ӻ#O5ʱ,rzrCIT7OL-bkF՘-o!NUM;eOMF"U@>T~ AAEuk$""J/eNqA@6aA_f&LM];$/q;Gr|&Rny Q3!͊kWҭXmmѤFUTgt 4&!uP}b.-SiZiR7׏ӦrGx$9/y{ "qpy]ogKLv6;*~nyO.i<*9UڸbqTbؗb薀*|Td[BmdWB) b  0Pd[]߮ˁ. ت{fV]vV*PRUٱV͊͊‡f]vbA}iu֐Ab~sG To/vq9Eˑ؉;o}cg#ɖXt$bK2k2qmcң ${9OGR>W"s :fqZ%4+b7pI5kEN4Cde$Zu_hk{e~ rPUlE+o2+^;zܘ 62"@*w>$(܄9'aU5E}{Jd ?ȫWtx*=  9a!nh=@ eu|2 w?=1dWYԂII>~nCT>h|,D_ ޴=Ei9 wQ|OON ,[,)\?1S$qle3u6ZWiKn hh b*+Sv`,fIS\U*ޡ隣rmVUc`](nOUU2)AeHwcfLt䢱& CS iD)N|3&E qD@BWk㆚{60/ް)!R=-gvc#I3o0֣YI m /ؑQN dWa# H:J :}0bSs8cnVfAP̬N:L=x+36CJZYcw4JuKfWvȠ|$:e3yO ?6>q޾!.oyMn2j xXCпJFxwvzE>T@pM~1O$nLӭrm;ة٢+.] kqxةۧU&ӦzdLmAM!nH^DMs\Zk6”e^6; Z^Es],m'z{KNǮQͭl#o| 22iqa|w}FsN$2-{᜸߿gSN-(V&^&GJi6@=A%kK'tJi4^nI$1M٬.nytrƉ5_"1QNڇ[\u|&trFv~C#[!%jtSAXJTW(%bt1N[@7uçkjԯ)$u|B ק1w=O4*q֮5 YHhOxԆWR@ w4DŽPy%6.$yر1T @+\M.ϵGH@u֘R/xWH . o܎@7`w24XE q%MYn%"zŖx`"`PiZHDzMN4ۦr3kj݈Uvb6<}oUFեS*xB$w<sd;'NS5%fP>cmڡ_{-,G@oc%UK(mܤwp;xdEč׽js/Kpy>yr辅(T}~Y#cSڽNT ;y%@l88֋@ĥJEP6jW0W#-a343n@H'փ ˈmQK on@fAUeC,m_o@dN[X2+Ʒz-2F 6|oY hʉ4-5~IuƤe [-b]>])dEM{f]]rc xbh[Lx,g̺2Pu[ِ(<V<BKF` -ycK"6;(yy;VSc "a L*8~U}>j O1i#=HFZ|[((N }q 3>D|$(YmM]6zxF[q^kз(?a"SeO#4M0N Hw9Jʴ%PG5~5EPOq1ǿoۧ? _Jʟw mCJA: F 쓽7#ih5GA~O42Ǜ%'>j`&PiHӳ!4#> oة.A@|A"7`ađrPA 툖g"#kKSdžxbNylqH w5Ƭs`!M@"$h=d XmlU(1RoJMrA#ӫ)j sx֛l>Ԉ۶cD4oFcJ 2c1ukƴlՎf(~ l~1Jw >2<M&+}J[VB+ `}ÃMSp}/ʄtє;'ri=4< =NK:R+teF N6X|;rme6zoM}D02cA015eE?l"eуo q: s޻68.d1" sJWۧ^JbV6%{y?,E#Ȅ^$"ӹcN擷eZyJFyic'V 0x ;֭0[,J^dZxRNtVe]Få 4j!ގV9 /'.4[PncO"ڝ@\'N" 2yM'|c192g^1Ѝm~JEZ5)BvZӮ2[hvY1540mD7Z2i-'2Q]~ҩµRNsoǍ~]1˛'Ӡoe'dYK)c{T'!9 F-?b&yx$~^[r",i+-vKbZև/-ȊљJm\6ɦr#4g5cI Z_l9}B[( 6޿dDۃu켯ga )mxmwtPofXT[v,#z^xdEZ.f$nE6_EuSnMA㺡o~<6Twδ *z6"H<)|E7 j-Ř5OFrkZ Ŧq(P;v#ߤuE; $d'Q*v'fz\=Qip\s Pd`=J|r.+#-Q-zTAʸ`ыz,r^F{ L[÷"!v=>#vQ[5#KS!ehv֎KdA"} 窓 ʋm,}dL_az;l[*5.hЃ;uE?zW+9Xg_KRNO!!̈4> ]ծG6xf4xQZ18J5>黂?Ege#z=mnHyvssQ/6`Q#yV|tǖH GkHmo,:q> eP#[\ \pq_CQz,p@-Eg\ $'@BQĖ[ՃJG䣿 WeprAOeZg7-Ƶ};h va F#܉5s]]EFW3}_;yy/rה"6S\,\cV2EEsSvO.,But{+-DO& fC.9pn:ߚ5-H]vH֚ ~"k0XeDDveM3Q]ab1|]L%>`]<̞gi&IE ąMNi:/m[Mm0^Fc{2xũv{ T-xGCՅ|G4sO*٭P HzTJ^ꥪ(˱_9, gmNZO$iCwddv3a: d|K=ýyV-|u4"EQHzŸfY#[XAg  `HݟXZ@>m1K\ds!'o?f!*WE?{Ci[uF2ktJC3?)sϬ4VQN,XԜd}dl 5b@@(*Doo%Kһ1J8P%[DV2>u)6R ᭟Z8h=?f>')j+rbF&b2IS1DL]ݰ8lߧO|׵%KOBk{AO: tWFwj)$2,XPL6_Srw'0ZVJm@9 J*M{dq!vߦ~]LI#=t/G ׾\ $a)P^Z˽EHl1Rq;T>sɳ@P፸4n4ʲiUEtPLJVr:;]3W\~`qJ?u6ASVO^S_P7:O#`~-Fk)2Mo-AŖ27=:MFx[zC'IJ$#{|SS?Q[;Y$pkɑYWGl3oeO#yY]₞3oPk71V-ÞFE21H q4+^ob%VFB$k~2L^ID*Xr&gNUk*;\GHu~ԅe$v1)B#xv'qڽAŭFzDTxӧlR^71ڒkZӡ &sMSKCN&zd#ynw<5[G|QsNu{@5Ƶ_mn D͞@y} 6met"4u'l+*ޜJsdpUߵGǒOk ]"F7(fEսSMrR^$Uv'u+0' 3(Y`}amOYRP Q>tݰO6ЛԓCEQMd.r=I12ki?Մ0R^L}{j#  ܟƹDnd8ɿySԶy, 2E>JF-2]W([I~,;}܇Roj'~S ^M^^=I9 a%#M}Wj@8]CnPn(}TdB2O㹗~/n0=]cI&_e(H&$ВON DYqloəjAJ>]2wH)y2 " kO2Hkq㿘!- yd7DWuZbj 3k#kM478KA{`vP׮=;fm24/Ĥ;/¿59.Z[We3$kE+ir4o9 / O'tR >EXHT?Hf_~d)6'8VkBIKAѷWߗbk)XHtFKh,fyJc3ߌ\ɧ֫mb7HkN9f@G&eNkMՕThFcIX!M>dz)B/׈'o,f& NߕfޝZ&4(ko:vY:6 o<ố:)5:ԆV؆_[\<=U5ùIM7oR1OJR_vzfzz7ֿݮj4!h5-PIʧܘ{F9:EtE']Ԙj(:f8jtbA6'>HGW3p1g (n`Px\S4̕z\U ߯/1߻E}0t>?" {L葭mjǓTÿPz~@ dgn>{*c/QP|S79H9TT=ŷFc7DǗG[$N>"=<;7\9a=zajv#Zl? C*ԮlOlP˶ I|) -v8!n_ 1bb1n*]-pY=Ő#avt؜ǜe3yu doӃLolZX\s,Ӄll?9>u| L=ߤ'Csyi#&{dH峘_ߤ_dV_~ z/s#6mI,ZLɌgc#wW”c\̌)ȈeV Sl({he'r\RNX"E4 ,PwEԋ1$mLQ v#Ҩ\uG ƒ%*%s2,$]]UFJI\|#ߩO+ GrUe}1 TWzVгOZl@ |ۊOIS/.;1]Aҭ;a#ڛ 6BSe>Yn9tw3 <$ӥbHȃ«Re{5}@%!m3M @ 9|NaPy`r!*1KiLO~yi}%X@)+'w]՞k U5b#( 'lEYAPF(9[n/^LU-J=G=`@GbTԀ\!n+D)UfmZ/cq&0F EŘa,j.YԊ!_AI:t퍈 jʀw&7bеӬJh~MWnP>},5 jwE|FX2m :er$S`QkE{X \f$PC{OKSnV)zG<(*>Cr54F R$ DRod:+7.3ܿ2FM>[{  >%vqr=;E_TJ~b}pRM!UPEOL%ɹn=<^fUʬT]kO .TF:*Yvgi>QO@ACZW Pn I+r|Zxe%iVH֩*M A#Bw zc&^ׄǽ0OԲRJepb}à3_yiBL c)pm#vx ܒOrY$ȥ2X{;@^O>p  KfMz>!wpKS`OD VWlG@m1xT5͊9פM|ld۬R98uW:Qy̒"sz' [a_u=1 ;6(^?=^եND'~h[A/[HԿ0gLр==W?RD#I}#COvo#}W O̷Yc.la%w=.ůl-a3},w'8V\,} ng|gk~RmD~e>YQO fH 'T/lz<97tyF7B_:2i1ݸ4q/w@72䎃mLJJk'.QV*zͩľw2KOqR1]Wv:ii#ѩGyeMLtۭ6 3Q5 im |-Iu}A >-}2΃.k񟱝%䋈Ǥ5dcC8} Υ$QҊY~3Zg9;]^,'Ǩxy/u<:ҬmEoMNIK 4/)t齶ut)uO.k:C$qj7MBZK@I6'qG|Ǐkgx|Y}\=[J?΄ɯ2Uk0YbotDY;nq/'``o;F~p]*vulcɉ f~P]V'dZ)csآjiZ:^?haq#I08!np+PzL;WPHf:PWy 1OD59 .DO+ϪPԀ~xGqfK*vbۦh2_cf<6S*"n2]`@"QȁIf<BG<;|H-%"Ssp7'Պ Q&v4é*GF?+Mu-JՐp{ď Ljߕ8ױ#m 44M7 )u.KH ZH"i^@LbFZUk)*8eǛ⌍RPiw e8T ` I jCw+_%{'wޏY^u=,X;j=uV0 iIHWn'$ * T&TjL |EI{[2E}zM|26A?.$Te BcG\d$ oll(Mv߿vn\v 94M2WY~a0lC'.$|1;(9RWC84O/^7T>%SCR[m6yR8<=/ްޥHqbduї6kKl=a*V.D9=˜*tV%P526Yt֊ iK#CCb~g#SᗨR ,⥃Uߥ 2#z-3<!5ܝ%.ƞ!=j(Ԛ+Qpu&B S֘ n54"TdQF>=I21F͖ȼZ G?Bڑ x'3#Gp92S~ $EH<3r*XdJoNF$TV)n!e|#0J{*LxGAL3AM* z2Wg;FĚ"R+C\ctMF,N ;E2W8P]G, ge[i%jGpO+Rr=OX?u tr?Nڻ*~r ɝ4zڝL6eKS{)LO5&1=_POCgE)v̊Vmzr/~2|?SJ?{ /Ւ-i#!Fgǀﱿ!oLPUmzr9(;45Ks&\]^#`iI~$6w)~[ͪcd*ħc&uFm֎GS87m,YOF6Rx")m{72F:1mcտb󵞛 (YdY n{x]K28TV,9~F`3o\;y==.|I;oW#ʶK\~B ܘd'#8hB+ɑO9 OPZw~/ /I31fzmiDo.)l̄\lvIoorv9o jj߯AJ%c$ `lkS5۱l b92xM+EyOw$V7L>w)w4P*IB|~ӭ$11*jt/ya/${dmcnE܂K 鲏GSw޴-OsBR'w'%JY  ,c"TbVđN+F TWz ʾL-Ҥ:9Ef3Ũ~]׵ fZߧ#Ww'DՏչᕜބ&- gq'~)R~{B5k}[є;cTTBRE>Wun zuJ@܉7@~^"3wikRDc4vP{57g=PߩRi,![M_6ځ-9Sc%֌weDwxkgjJ:{B -LaM:-׮y#!,fW[fUf(H" @.֥iSs>9j4˴֕dLn[](5p[E#A풄4-iTI]P9N a ,܌ǎ'.gDH+G(CLN+@zMGR@uݨ+.4+g~PaED^V>R6E7F.  $|м5ⴎd~'JWRw#rKTyz-T}f;*Mwmo 3+r(()@w$Z= ({? vk;ˁ9Ew?^sX9$]rT[n [+{w*%eIL}64DNA=y\Ouj r{8sQa9!s8_^MMSG Y og/,1[Py;,-yEXo)leGh>p~|~S~_ay6(W׾3ń] ;C׎vݛ'=y1"<˫ȝ]nl(Sr:Jwm>yRhz$`N`c`32z>N7jg<Zo[٘F @@:ReU}KSS5<"|3>cfPx3Cā*;JyOP]?I 3+v+ 1ښz( /ij?zxG|O̍ݞtfHB@?GdQǯ ijK0=Vx-]%"}<IĎ~4] |~]kߜ0[MH+i+6Tƶ '@cf|qc>eyǚy]鏰5 aͬPi1fhI@CpH@6yǿ?6cJ&FbKW>s-q~Yr%+1U9ņE5 DE\m`_ i8["b[ApI'8ɍ19f|0T_3b͊/vlRءXVZw͊6*Z‡eKhf«I0wX}bmŃ_rXA%3/z ZVa"9%*K],.iRs}1것W"Iǐ@bo=z|Z(=fmiŒ( >M|`Suyİy?V>6OwqK+hI!ϾrMo|=_4䛮~kZiCU׵)r4B# Q @߻q8?}:$[e!Os+7B*B|+xbvP9. o2#l<|fUM~چulE5,|D15*lwմ M~E+'W-$?OY5ٳ!J6½Nan76ɑ,?BZjOl7F6iQZ)X75. `O"MƟ,y:_i$5u'o^aj^C@N %0kd#4QȟߌʫJ%qQU'ʽ[K0 wlEC!6N O*IF*%6ȃX5k*,68t)ZJrpY0W7!VUbMhr Ibj0,bPh AӈvaZ1B [O醭28>t8`p4R8}"%boL (h4 OB}Rv|U=6g$= Ɖ$ؓmuFj4&9.ke#cNk}Ayj[ +\Fbx`m6#1ꨃ.5޽vIjz!**q-J9HQzo_VGp|3#kΜwo"Q eѕi0=Pr*$hC ܷkZE3.q( |a*4rL0۵bǠFa訸8;/\=Ϙ?Hp~ Rj8UZ?-T 9(Q'j.bH"U2 ws,#۶s VWp/=CM_#zzvejW8jO|ڐK1xUٌj7=J۾4}Az] bo{!iީ!wdyH[K+.zPTpu!%Z|2$$7qPwLqn%6mlyዻzi%Yb}^z^X4&<یQ|~n<8, Kzjܴ{ nA+O{՗e՘^jbaUecڢ~AEZO68K ^12Lp:L}nʹ>;/ܛ_m홌C 3A@N6KϪ-#`$w?ۚf ~ԜtǐZh^IV~Fk0.Cx{oc6p-V&7'L%I12>K"bTe'}`7CY >u۴'cdaĂ:$Zezax{áp:6wLA0N RE<sqKyGA(=ؓHϹɇ*I4ѩֈ6d+#oPXky9Z! UB#gW<qDbQ _'ߋ!2jPPrQ ە⦞2jg ήD18]{X&VzqPhȪտd W&<;]e>'fg5 hZqCD[!x? ߻'bcb^B;)\zsxyFQ'=)FU=3QXK n*vwwMhA$R9Ԛ~V}C5[A,H0#&ַ>H;?3ŌŇϷwt[&8QLYʶ:(#2,qH m$XGIVrۙZO$~NU&b?VYY>uu`N^iy?kEw%'V8R"^ GL:XQn~Ӌ~u'^#8 wΏ`CG@hz~x>B{DE2#tDYx*#v9ˌ`m#]%7?MABFPkʿ$UZfgzPࣥG^+c:6Amb:BɝP y-(t":}'dCOrQ&jOåpH*79\{ ͒)C*4b:ۿRqE~K.݇ -sϩ[R_K魼]]~ʩbM\7Kf5>Iu9d ,:SUf>F損cE oAໜ .[Qۿ""y0Ʊz,1P:/j׮>K2 #J rbQegR_u口$pzr4~ceTU.Z֟,$HlYLIA^5'-R'sSl@!"/y;Zܬ|MƊV<@+/W (8W2I;~%{ɣUnވ}u vKPөg:5[!cɕ>g_8)}[m=a4h k5 gw9R"x). #θZ1aL#'և|E": .{|zqyA܊P``Ҡ^P Ҡt=-821$u0-FFP.?gp1j"~pXԣ96#L(/ .=)x<MN_O W6OJ0PQeVhU?yiڟV9GXښ>D8d{w.Z5[};R"6r z,eӯ`5(%S+OP2;z? L3ݻvyj2^XIBB~hGӄuzF)yX#K{7-d!0^564y6N) jQ)_h+C5t <ݖ'eg՞dX߽~[cseIeYc*:"M: Y4i#:ba:IB>phK91cg Sӿ,C'ߐw/4nn  0YOrM|C~W\nUr%+.2%Ȋ{b"Kt\Ƕ(068 `t9~7pszO`Dk64&LAQm9oG3_3b4UXUV(j͊rsbfV[ٱWfZ&a=;$TUzW ?E=?tߙMm)XG w>1cr©NgwWDxB{\ e$cJ%k=Xҁxlv;Xwb y hT"FoIdح}Q2Rn75 ޙ`|(QjW55pQ ()@^9n9L$0ħ%e'fX߫Rn{, |@Y!~(E߯ȝރ37رT#eb=#G5Da}G6*?FvY' ~JSifi´.<6Cx&+Z 09H<[O=OID<<:2+I;jJǭH}8_mS[20g<=nkqcߵ<D A_sL==?NJ ikҮV]P2Mrv?*`-[j m_ UqBvZ^!nu˙$XCR}?XGQo3p#gZ96ԵESҷUi{4Ec8c:҇s='cS=zReo T?mNgnb/ff hh5 !3N+du~{a5U.&1OB [] >=+FͰ%} xc(azF !f'sX9>qۋO CqsZG,$|‡)vTf=Y d$a|1q dI 8*ƽEpK &qA>Xx"i>sGu$Ƥ{] 6@R_@ k{狉5H^2AB = Z DmOizIpjCmX=AdžKI r ߡ[= Hq=چʡ L2A@#.#Z4qZZvwӖզeJWǮ ИʲZ+#ctQcF/S >P2 'e_cKo<̟$kW*f=D-enf@mno_NaBSCၯ<,L 62c4/Wzk('T?a n e$5{|+gZWcF C҇¸PT<]ԊHJ% s1 xjփ_#jBAYl%0d>5j6:6 - Fc9o6I:ݮ=GSҌLH(AЎ9"7C}kEsPUdvα'4ƕ$cKh;1Dl۷zA:7!Pp+(ñ}-# o߲ꢻoM~e<ѪkDT^M ~QIعuSjq=l 㭞+n$ lv( dž AvQo !Ȕn9KGly%k #z޵{?Ʃ tUP{W)d0g"BҌ0CZ)ʤb$rH&a5ej>|y ?MLjQi_}jN>_!Ӡ>/"?{ lĥ/廨Ye~M灝{8b|:up&YPlM0;`oB㒝Dw4eA =?/wb1 U,OLaq*s&8;.EĬߕ<ԫymuq|%4#JՏ\jy$j:㿾bPw;M@GcŘz'gxe.!uz'F;-|CG%2F@7ߜOs,Q: Nr'Y) 0&!elJrUX7YPװ4۶FHzB160/ۍ?QTm!Z%&ȩ,aEzsozRx"K57VkΝ7zj6ӥFbw?p1sqe_~[91<1ށ ) *j/0 x_! { ːGNqJ0Gm.yn@ 2ArtUҢm&i սKfJu4 ׮R"ڠ"_Ni5G:k[h TlZbrUЃB-칐C.ytlNզ@cX ق;af޼EX썇f ]`5Jr=@dY@AKnIzc$V_$/m [mXa/}w+zr%k^5ˤwjMZ.(xû gcY+= ,m̚ÒR;{x¥Ok&ej!ݴ/U- \ uoӱ64#B>mbTʯӭ jGoK!2Da+KU _Q0KiWQ_d;DAn]t,%hx#%/ْá]] pyٟKAG>#d}{3\EnϿYFT呕~<2D|*_jR Z!Gwop &OǦKt#=7䦤t2ګ?A)n&w>tۘVTv^l4ݫ1)꺁_ajd39h珐omap d4 I{LIJLdl @|*ўCTt0jmVO4hхQ]Bz叧;_dWG}8.ӛ҉Q_󌿝-凚vp4[\a|Vw0wub6ۧ_q|rI;vϐ^6DӾ["w2]5S5UރpRo班;Vqޙ] zSIv(ة?L95ȶSt65U3nz*YE(E'`&ݏ&I_@N-Ave;("˳?VA @Qu,œMFҴSpd"$b=k~C#{]W[K&U* 2A+JF{Yc$wyY%-/ZInMQ ߽~$`iҴfVȭwc9?QcS֤XQ~ ҇Mi0f+Xd~0~ŕYD{M S0L89i8M:/5Jo^pd<`DKDjLKHŵrL_xæ*cijZשGr.<7Y2of" ms_}mLP,kXUFֿ,AL)mΥ%܅gV>݀᝔~ջIɍFD5֞Un$k+Zaԑާrqs{ ͜2fuCJS]zvZA1/C>"|<YR l 6,P֥Gnmɹuwg5{%zL"!n ,{Bx h8+?{o,:o AZ̆AArIz/_듲+i ߮"ZāA-!> w$?I.@oçߌ3fD8a3vG&VF2-++3T|WF^)Z56E}1!92I#wS'&44". Cp:d #owᔚH(`ԮgS !䰎W FN*;($Sۍ.{9ԫ 6DJo\Z&] X½iw>kIo;A,wW;U{u5=Pϐ7`Xr"(gG9~jM.fZv)T4.49p/>iw6FfG&޻^#BW74Hdeb+N6439mSߒgҭFK44Qk޴+L=q/c]e & \ڷt]Kfo0^=(H5Ⱦ<X CH+F~|=+ 괱㄁cóh9t`}̯k7ִa5}*/~j4@Ӑ=qXӬm+!]TafLy!4F\> piLDf5us1?2ИOGJa1G?qcݯ _^=%Vmuw9{^5?߆|ɟ秒JH7<173 "cA(+Sb:xRYRKyZuqEUyنYϚrG>5贚s3B_FO.`1kr֙-&wF'U䍶Fkw]iwFQكzpDw}Y{?U,rcG{7&%Yk@=^#,+r'h sNo\k񏨸>0 |A2:Xdz$Fhb}I\bZR)?>3Iv<Yۦ2ڼdhx`Xu9?5$RO>G66y"2O@wTA&4{(55dOܹS0mA Ə0719tG~r{) `4S|$i_&]/?5t@x-ݰ:T/sJl)0]'?Λlsk`֊4|:~ gdK%x<'˪yNIk<CI_X+e)XTW_\Ϝ4?տ}>[~0;j~WkS:+rkYx6'1 Foawi,${?usos_}8d0>(%򶵩2pGkXyf=2yOJkwڝBשwhnDpO {[qA9O ;/]smM2> 3^D'C`z?-kie%q{Ϙ4@h{ғYɟZgg๺X>l"BCRĒ:J7|Pd t]Zo@Ūŗ"[V\x9ZMxRw9~ e7#]7:I`BNƙp9 DWfMwm@12^1[q*Wj_3be͊LU!ZlUm[s_;8ljJF+O@K >3cd_tpA޽2Z )bRcs^O5"1҃Wz88kw~O%ȺgW+V3U{a45} AenNV}d),ʃSB_P~z8`=P)HrE rȋA#g;||~>iu)&JNv/'2;1 ՟`Ѝ#EǻG䈡m+@#ƝI+A36! r%Oڀ#^j$@v^0D*Yr(%H Sk'ok:Fj*:rOk"÷y8''Qd~ ;RgsN=>dv;1;4K4,LdCpBuA 1.iIUi8Y 1W^EN%;+obGoK1іȌvL^y֗zI=|i:A^euGfGZS۷Do ;ڝ "v,$l*F#5Zmyd a+pSY&Yz֧Mdx|0ͼcnVxZXJ=sXcG;0 HOӕ/G(xnn5iSXFU>]>w[QAO߲0_M3ݻQvKzEb|ޓ-@*}¹"m v,~A+e֧@,t>|ppZ]7hv*vi5$Uv C FجN*A<4e7b ԨH6 .1oȝT&p݉5-H:dʕbL4ɆjFN~Wo0^ϧ+O'όI|>#3yic=? (Ist3Co#>/,6 SV0cSϏ~+15[c\P3(DCphOjb i##:l%J> Dx|=ʕX6њz}g/?z 9 a7sy&G]gnds殭SId'1Ut^le;vLlWj,kSE,Ɓ}3óe?1 MחSQqi4-G#|O}j&ubwo_{=u9ߺ~woníOsL5>ONu %IB(O֟<>|ԊP 5v$2Q@xsUXniEQ||߾le; ۯXtywdiZOa*I-$Ъ/ZmVc`64RDqA_eQ 2vD5CKŸ6fd1[+fb I;aB,V>ԌO>8J~-:~'X.Z1n;G0$|OSy{G?z*w44ES%R75!OIHǂ) $cx+O7yR`]5tI $ՕcOz};$]{˃ŧ;tQ\r_#ʪ)<(k#: P9n+ԁc=e",xƜAo Qr%l!\qYN(#M|>XDbhTe^w??DEv.-*rꀟ?ŤiFѯS=HߟvsTA}3[Bܕ?މk0ȧ_%XtğDJaÒz)q&rgE mJ-4<-؍'|F ~ 6eJr?NfO~?XQm+OR߅s}clIz7='(;`f!mn0bwu>afDyXc_(ss_ޚ7s풿-VF=5Y;͎Ay[u?Edj>dὕJn?%*lƅ/.4 [OXr_w{'6? Q>#33&QAR,P#q?ͰEr\rf\=k_J/?G_涻zlwtGuohȔLl$%*̈rDchP'2-O|7o˭f@Y/ԣ }(7~Nl]'4Ӵ-n*զn;/Mu9!U ┢@r:~~_y3zߡt:ԢI$*A n)NBӈĈĎ+Y$e"dI76K8,H`qDQlFޱ3=҈ϏrIol "cw1;9qWߘb̂o8}'e|B 3P̮(kg;ܚLO:=`}CqCږ3%WUkGcM6'L^HSAg\4#1)K?Weo7*<Q^̊m o1xᥦ]Hp̽+nI[v<Џ(k0߶F*~JN}j9RlvIHHoƛTb92ӷ 02fm=+J6ߴ?V|=ߤ>qC$ϿrJ=Z8kbyHOr-@Oc^czoC~ȥ9Zvyyu$Fpdmv"T!:xdidA; R ʸ"RVݖM~)g?&Ѭ좊F G)C yN"D{||Gdq/*.4-F%  \3;xAAۮzC,gĀ+CRNyKwds衘 ]E,{bTh,2QAêX҃( ( @re M6Z.lx28G(}2meh,3J 2[3]7BWO<5ۏv|w7 }ONهeV= 275G߶W(}Ξ7aiq'xjOȆ]$AޠosG,DlO$rZԬ4[(7'!T^$ԡ՞Kx땹M K؊|cZ/hBE}>o%S}@$wWJ򿚣x岗IVKix%%7G,4IlDT%RTvhfODb[ ̀偈Rc[m<_IqNRh$O4 :z沒Ղ DJC6;ˊ\čfMpbI$yuLWW~y>ޜ0>p"}7U~RL+횝?j ^˿kuy% vG49J1S$ƃq:oM};Hj&9#dv "XVh8?0t诵8Js* s]Lu .'k}ڽ=hήX|-_+SoV--%Ȱ1%PlCFhTFgFʔ懕tg\ķqI}f1N(RA#9@#ccpB~{ )u=Acݳٮmy~ZտbQ,??5t6VE !LMK= q;˯'eյ B_B~\zY1ME`2[\Fњm֣!۸e n7F27`z?<*ȂՃUwV0Oq]3|G\'zcLcLĝMÏ q2k ݏ \6 ;[8B-P؅w-S?̼UٱWf]͊/ 6*6*FlUaͅ f.,dI8dT;D* Wc??s?b?O_G`s-}U%:O@ &'(u9Y?VcLbM l \H7FWhKjX"V)(fRtژRj2&[~6A]~3 &*k)V+]f`O8pAA肵,tی<%HkR dȯݙf*6׮Th3_z$OVwʴR!v{쬘[H?Sx҇%UjfS)qO^N]@ߖߛ~\_Z'yd'n'5v82Ly SO^C[Q,N8}M48,h.kI' xa OB(_u^C,epeK+SZg7l(TMvIN~L/2-ijFxiJTr=3VNgDPy幊8}9V5nUm[,e SaZ|OJ6وXP̠T6g;W+ 舤{H4/6ʰ[9}cv!n92Z4O=EV4Nu/!X1ttZyb;Ӧ\qy}1<uq$F)kab =b&ŵ1eH:yvV+_qW'Alڑ'#o}c17;ӵ0y$<6mkiu}D7 GS1s,7zf.QH9`$Z uO]ӟGQyn6~e{f#wh:TE)(l8VT!h1H"(!QvڸL2c9 nvh#|S_v57۽vsyny0Z7o H7wA(ZW1&5~Y,Dd?nū[E-Ϙ V2wq򸰞)A߾ ]B{\|&VzW2FC䏹<)u ; 5Cˡ dZuoݎ!rJS;,&3r{IP1됭KQ@;\EE !:+#f$6ؠOg<ǮI--T5HȥWK|Uͭd$F ƿde4; &ݏNYS'uVhtۏóJès}#!Œ]:Dwo!O)3~`aVV/1kcmˏ.Yw5ƿ;\/-|Nl>&P~d9xj vڿ=e:6}3ʷn޼De; u>x1½[:8e/~Nmdtrqsm^Ko*w^AF6>b.a~a%Cڵ?,%?- RVAh|ΏǪxs?IcxrXe_74Ǚg CPlNj3tXGA,$^ X3#D ځ{i4Wƹ-i#{u7//̵yf_3kۦ>;?#>/;od36|G?3K8 #!n-4`spYyŠ)FOcjvk0\p|~[fS2~:jqᅬ"s%"P=i?0T(e2ۚ1?00~ ${G[6Ȕ#&X_H $ )5΋7i~>q=nka 3s鎃qV}}uR݇RҀ& # Ly~rc z~mkTB(i&ju;*Nï#HJR>8ࣩD>v]Ff;?CˠX]u1e3ݥ(Z 72ZS֝$φ6ٷȇw|YQNڦGz7*ȖW< Wd`L?$iQsZ6=)En$Щ${/`'>^еCV4;qx& 20V4̼+QZlk&QT27U80,n֜4myf wx%Uq.ȏ*6g*4#>-apGPXb54 F)ZƐj68qknV 2~tGF7&@6z?'a߆e\1>{1.\G'MruF1,u)GRy^ҳc(}^*%s:Oi%~9Yt+YU"tw?v<&]߀{fYXK,e^n+@5$n ϧ\"gRz4#Ͱs]>Z)ԟzqHR6jw.U@yLUbV~>iFE%CJSXd|,4T"=L4=llGm ~hjVwD$Z of9oQS}vw7}}S2^; L>,z7η^ff^&m:@BVs-o *ҹ9{+ (Ft'lUimLJچzN`g Tw|>8pgwd77ɟ~scU{lJ} VG ~i󌱹}h;U# rE4 H8NםLx#@^^O5òSs=HmR^iA}DUk}B5~X~ (GvH@DwKjZ]]DZ9bqц~ߞ[BM.OشݏpF.$4:oPSͥ94P1:퀲][z,ďM(o5kq v< l:tTe>p"Ŕv9 IC%zSæQ6wX \dNN5ً2-a?(#!ϞӸ.0~Ŵ<YF{/'+O}^=zz>FFHm6.HfG~ n؟CXWzPx do/J,frbȫ6OaC>p%?&~#X2w:RZ;.h\f (;uĦ; - GCS8ckf@$1!sX[ L'ܪz{)DA{=@=oTIqA OgMk0FL0v©X܁TᇎحH+ZSNW@1ǁ^N~ɟԴM"2~靲T!wDa+e_,O6j}3EגyJd13+;c^~ ^h w?8jF&thٺHG= _^o{iA=ȟdR !܊uյnI!RĊVxz>M.y=$Em7kvǟ @qzH?9=6IP\<tWJZH B(ƀO C3˨_71Ū-Q.ӿ> >HeI{)t˯xG%_dXߒt?]DԔCmj#=Y|Av'ߙ7#H23\7-.8U3{dc$?F~ď_$Ic+b틹drڧ"XU++W, {Y3Y?҆vn'杁#oeRB~Tߏu9a6X,ϵDOc`[k|mGl0G+WjJvW?!H*}' Mϟbu&?)ǝTߖ?Iy~=WMԭ#]lE[}V3s%/og˄<՗S䵹Nn0b((s^ ,j\nZIF z{cM#FY4GړhIkk\yLեB![ijW&#wF+t\2!i̜FKU1&#LĖⁱ'c`%qS!6`bk1@)Ii=@pS`+qAv( []+\!mz=_2KbXvlUٱWfVتeaCS6! 䂡[i 1AD%-Z؟sѿi/C>?g9SQb_34 `u9Y}Ja{(83dp6l"b7$ ǂ.ˮeĒht *(jp%6~HoMt5Ep+ s&8r4q dEQVtb6jq|2m GAF7%*/T{1VXծ#VPwm벍kĊ:ucbQK'C{W _wK%94c진9hq#p9G/*^M%XҮjT s Wܬ8v4 CL \YN?tth\K_LeST?=cE}ǚc樒?9Dl,|@do޾ž?ۖ_fyJzq#vsκG !3wIB-F`ztp 0Dm=[Kn{Aed7kڝsi>k_E_tܡH ǼKP9vW?Ss$4-mx2 r6nY j&##Ů$u/8Hח!բj2ҭu4xg5t=^-aդJz1Zjj}T}"M=QO46Te~ W{;O+?I#u{S<'!ۓQđ3m`<3cgLJje/޼·.y/ nCexDJV'R9Ah|w:uCGn!3`eT` a*=lmyw;ڹ{c$11BuL 4?z5䎻tZ$K:7~ǘRƃc 5-ݣY 'kR>%1hgYe)_թv4]YARCzR7[]iey i-KԠ;zdje|uχox>Ono,NYa`E^u9ֵ/9RƧ3e%N0O>LMcFAj:mz{9ޠQ%^&<2Yw3[U];[Aw/je2p;,((l ާ$eN6\vT:fqèWZBZ=6I :x#Kky/drS-\%aNbG92 [B=ܞf:/:Qm}bmTaOn%?kn.50 joT}bCpQEiailVYn=mZT/~U.0/su ovɸ|C K Gj>rΩj~d{M/I[7wJ-+?U=zG,H-oTjG6~ ݫ,) ދ=i4! Ŷ7}{]󞟤)`Ү+5\ roRynixu?LWOmtZw9<Ҏy@nΆ]Y>n5?7bʥc=AXPih u;'='g/ˑ"6NvߦOuSM?D7v];bIDIhM=.-F-("5׿0nO;sYɩ[k76D4cJmn4rO3;Q.94ڥ>ñ.Df b3bU^kzXjHy;?r dc v 3OH7ip(H+CٔVC 3~l~P~X-M`{S|JeF_Skc^8g-\3̓~SyX1$ mRgq?6[SICRZz3`ɎƸi^2 rU0EdL]vR~Y4S?G>@C;!}>xyN- wi`#Í]|{aL7.b,O<#SVsp:~?0ʭ| k\o~Ŏҝ:s+;ز'į`}l ,#Cc~?zp~U޹_voixZl01>>G:UW܊oJWb~HJ|+aAOor8L9[]!ZԑX#XSVJH:y.?}kfr:k} vF8@9S; ڹr,z|!~qJOGOP.%mkӥp,ZǪ=w DM67>C1F}e`VvEݏMe˨O|28~ ﷽2rr Cg/p=߬zv3_Ɔ$dؒN:R5bXiZr"8u~;#r?g>y}L6nB@,)nvgqjEZM;>9V9z e7=/G[gf,E" {D aGbvzuLV+um>G3|jӬLk[¼(eHG?Z(52 ǽ=~?v`eGnO+-S!_E8{L ; >yEA]XģmMj~y*hؑJlL; 1J_ DydlQcT߶_oO=6˥yw_}uoPUy^ K&5'ރeO\"# ϐ?-- AwݷQ~uFo #NI<3( GT択7$qN, [PxWYQ'ago!0ڻzfh]ejͿM?lEJP97H'wu{Ig`E+րoOcw;" FU^*jP)=_<)r{?'p5ҥW5x", 78*i,jR'M)m"9-jFӄ6AM閨}ujIIY!xVx<=ܘ|?冩 K}BFRhGϨȳk2ݸ>gQ?Y;e~H]ga[Z7v 7V  軫 F' 6{趞-H/᱉nqȗލR;ʼܪb )1>æG9ʈV}}Ky4G3,H=K$̜o3$m&MBZHF"]$42ѭV"m fD|-07̊өbz`^ʱV>_ )O咗F˄Sw1 /BOBO3{NH aMܞ8bGosk"(xSҤ%K)↜A4_8aCnuMB֙9eӈ mAT.Qje#ɔ0@IcO, ;9h7moi+qhM?WXH\؍mVW3WR^JIe\VDP(V;fGsgӁ4yIM!YHV$ִȝ͝B?bOf3WC۽_fi{i2#|%Ln]:Q9!T^w*VHXɛrk[D7>](TvaC진]lW0,U*{W20S+k,2Y&zY}Q8'^IԴQNƙxqDwӌzWƨ+ӗ(^{qP/% Eo,_Bk;;J"@%nƪOM5BwcLw1 ${ߑRZj5˂t[c56lkĞɻa hKeW_OQ4cM&мo4@)3P(Ie;waضBȾdϣ(˥!>b ^jֹn܄lz}7r9c+Jzc$0 SѾe?*\1Kx;T}"Bq]p(٬Tzhӽ6ҽl$z$J,LHrwuf3R/O_fwt\a!YV6ڬx _d?"fAqgg=Dvz^FF文f`\$-;a\o.|H)8׈>R9oC^ӱ"۶ KL2dK&S>!ؓW.ĘL {K^ZIPFֵ2 $(-Y`2n59Kh'PeaPA C(ɥY)q!zc.VhO>T?<.DOO'Oh-e $vڨ> aEZ횜p76Wp "@Dŷ0FNw2s),V;HOOm?dW|d'Ijr k  wbIv!vƯ!` )#ք~~cɸihl?+hZf"jSO=v=J…n>ώCn'P5|*,^yrP\)iɖ]R۟M;LEU⍚nhy i_ }9'Hn?$PH̴O+Mb%HfBWz&N<'?3Mci7v 3^DۘԂ 2&L%GU 9VӡRƫO  ݬƹu3P|GGnZ \4,On9rbqjzTz3t兼l2߫Jmen-NanTl{5̡O)@6ʦ6j*V(7ɔZU#g3T*혦g\# ڰ,1pMtndd9; XtC/M7F>wnDTgjr?l<![nkk ~zLu_H.7[$"C }c#<=̇LJ3js iVb0Pzxvk)쏣yGlʆN%l-u+MV1yLf3S=ƟOLh>+?|":c:‘t|w}"鮮ޘ;aESAu+9#]Z{ip={FJyKzؒ{˙]Z=?Cd iO^=_S6rڸJ 8#O54̯gJDI6zOu1ޅ/<Ϭi]k[lIoIZ_ZsڷZE;,:0f,q$sۨQN11&8^^-8|̒-dJbmV#ǸY/ܑⷎP'lgX1dQCW6ĮcwPS֑{`[KZRܡJC+ʫVaK;Wz~Gl:|f%f]qZHpO$%q˴+siKas˨2\'ua\VӰ*Ff*@u|'.C;}@H;yXQTE|AEioasI{f5Sj/7(<=t~XP>|]gɺԿ/mҒOyY98R6; Ejt4i*I}2:wnꡎP;yZOdg 0<6;I&>NkZ;.o-l/)sT:7j=|#|/5k(^7kȔt>TWs~JӘ߸OR!rDdy;˿~N7-Ѽf5b`^ddP7Osnw~2Yi=1=ӭv#EZ#{,{K/Y3؞:4OK5d(a9R:lO那Jї\A?=G7ސE ?ߙk5K}Ir'GA Q?qOEo)j4#\X>J;C)~tV:m5x朝i~j$@;(d=~fMgH9:뺯SԮ!09$»v9{[4=NX(/Vw{[X!E?xs)ѵ/=BXRKz*5 ϼrCEaN5Jʶk4Gf=OⲼ5C$slII (j+ǚ249LW&'-!H7<&A%N~y-ѥVJQOՔHN ~)gt[ioPR>6=!]&XdHj'߉?Fc0߽2A#Ξg>:Lx!e΄q~Q|5P:M^_YQ[qʹw4MznhIV0Ց˙Rpe3U2!|L̰:û@檠 r& ݪy셸z&6+Mҩ_& i"@Y1M4z2fwؒX 8KК#`0riIG6)GK]ʗq V<Abidw"$)mj0ё/%~(Ej/4-1Gcz(Zskiܔ$\zFo=%sِx-6Y\F/矝^B :֟A8F 7SƀDbhxoJ|} )'?QKP˒7y;qjQֺmrѮn:F[E^E;<ըϛ/Ym FtZgL2<ɹoYc8Q/2%[ſ֒;pY2iXmv(3j|nl`AnDvڔ#saû,=Ϝ3<Ѽ[F,3Z[Ƣj0]Gx|A9i*j G%3 g :QLZJc8ն,I*(ޔHFJpxe YxTHQlH=ve^@רnݗ>3oY-p+$ 78h~ N99yNyqRƵ3GHg==_`z8q˭~`9C1d2{xSXܾ_!e_ )2n7 [z8`]چ+-R/Y\B@}7_笗hhcOYU桡yIoot]Q vrZ\q'#+R3i,@5$fhu K=|>9xEUG 嚬qfr?^vgC)Pqv߭'X=GǴ™EzɘYߟ3#:j t2~pG߆cC^ uh)@:fcJS<<1$7*ZZu٩zʤzsQ)ՐPrjv,H5 e<]zPdR a^F{y]Yzt(fܷ%Ձ4ac9<$54`(6~w3Vk#Z@I5UEBiS<^%1''B{HqbOA>#X;0XۅvC0$Ankj>~uo,&CN%ӛ-V{,K V_D[X%|khY߸n41G>e9:d/$,RYދ@w¯0jLl-2ʃ/ <oYO_AM'k6)M f/jw^:$|\43'?gyf_$n'M*ɸ U>S8?u~{ؓ>YqU'ggawsBӈᜢ%H^ !O[=OJ4D'~3j5a"G>Z7lԮƟj.>+Йfu+EKӷO_ ,Cŷ,E5?5SXQ_=1e9?H}1kSh+43K\~u5F$m@fL`L_",.{-"z,_g8&yXvGphSavF[aڔ )"ŊoZ^O4E61I?nVEcMĨ鑫] nB孔NkUGmeGMnFepx@y~MnXqr GZaNv;Nz rȺ` a ]ކs_[cQRޕ:^50ѫ%y??-ҮoR84VAKR 7Q4)Lr?{ z垖֓i!͜zԆQ"$E+1(S7 H@R)ROGfC*וš*9L@&kAcAvtcp-`CjIs'g989DӛW81 3ߐOAN|?=Qky]Wsv1sA!FžgeS,l>(A8٥HL&yHG,CO{ /u'چ!cQ*͑3y^"&&bOıE t<\@U(Eza %?,<t>uӶO Ԯ #-U͸ 8h>o!4KgDwZH7͞H"A|oV>'ɡ $Z&q\v~;ØO<@[0|w7 UPV=دB} Dzyc b}˨@ q#ђ?ߌ>sm?Lˉ[y6j+՛c#u9M y@nu?g|LRӟ6=3ټX/􎉫~Y^8itEubTszw\a`*ހ)Ӧ+$iE7- pV];bJIu{b{NnU(%:Ȑ>P-QMPz'z{GmJ݈#yygs<_WD!>AK.\r'꼖v7=ps Ў:ם dzSbͤHr}Pk!y^ծzxϟɸf2M5imˏhF5m.9=L^JQݼ3[N\kʣ.C{mv 7b=hb67O'fqM;R4[נnȰ"~-]g XUo8Om{4g>o h͇z{r#QZNvRh"hHbiz۹$9TFybh=υtO1SUb@X/IZ 7#Qxze:D= n<@Do3jVo;I& zy|6 _ 3uz c۫(Znug4Hq*~EJӣ],VvQŹҽGݜ^i:b^ܕzu~de$yEtS$^^>(؟rI2;֤r؛u'"j|hߑ5k=ʠRv#~KVr$v))MhV$)  RQ+q~nxƣܶʾr䎽ЬtIe-+AN('V:Qf$fQ@FӀ))<r=~&~-tFmZ)N?N @Bv$n? ݆]DK?QZۧ*s*joۉN^΢7^Ylj戗Jksgu}vc#p|0/=]*G-)J|k(#zc ؒv'g5X8FZ~_ xMk5>nE|nUy3'˦ʢ9n"kI⥋)*?Y郄Mlͥ@YT+:6%0"6ZFf_o!,wutYGoMӄo@~TՍ(O\ wl? iQO*0ƸUtgK04@Pxdg l=#w;%YYOُmLY2][Oӊҟ=k~}j}r8xwqW %ejF4ҜOѾJXI ?"K-ǣ/ s棠<ң o0@Ÿvp-81%_7"Q5Gꆮ!?lUqcڄO4K-X/U}ZnPՕU UG#N,yɉ*8cߑD`!4O&j%EkJ]x)>x!fZY]]?P# >z>[۳RO9 ⴳWv^\pdIkث>әsFG!gOgCҷK_M/CD$89嶴.5}bGîiM8I#%t$]z U&2~Gv<ݖA)vLrџ?{ѵf⾽6]6! D7JEN_Gl~^Jt:mKSxnȁ]W_̇"8rT=Կ0ŮF+mXiŮg@_xF&Bg(9A&*l|36eEe2-y&ږg滻HίcAt$ T#-CZs?b2o2lW\.;B0"ݍN} {=0uȖeqk#f< :a) ;R`gRJ| R)Sҧ8k7טtЋCj.TyjOvQ6lL7|A=7TBD#<ȖQnF[b- . K,X - 1U\-ы`0[xDW#m:o(KlBNDdYR؃ ؏|+K̼UXCb®͊6*lتaCDf sb͈V/&ˢ 3" h+bI-{=Y(wB|O)*ws/NF{OR{s=WXnI+N"OQ"2mP}Pf`8^ho2s4l+DfOvV%ГFc'**djIVg3\7ME)Ӕ* V?FN23*u.:ޘR׏dRdM͇;ܞsۉd {a:c[-0lmjGB=#cڊNe-ΡL4I$ SO\+*HT%Ochmcr@GFQ=>31$0UJJZr]퐖}[Q[F1F>k8 rTtUh?Ae e˘_uzI6y9[;ንv|\+?t܂iil9' X];zCzv9H]c&Kg3]\?DP~,㕗ziQj" 65GDI#Ӡ u93BUؿ'43EsFd-C^%Cy++v,?e a,_qÆY|8S -:SFHMKA  MM3'b{r[팱!cLkݙjIDg!f!ҟ>=@/H-MO*2| :???QyK)չSs%GGӛJi(T1aпadd{{Xv:W:uf)-@ѲL1$=0i {& qz=~c(ds|ˣ;W~k '.[JV!yGQnLwo^3?Wxqzy Q ~l$Pw AgvND|"0jI*ȟf:Du2!˯[Sى7 ]P.a9Co̭p~cyA#˯6(uorgSE@ݳ)zs`v~Hg?܍Tf*|xySL lwA!{%zi .@&Jk38E,m")#"{tk?_ѓjbCxq0ܶ9z=Oz`zUBIo^O4a|FH:1)Ja|{LӹĔYU|.ҸȵV y7&Z?*T_,s½EqA]J28hv뿇Y -uI,^acq) 'W5DneUo9tb n,w*]ƕZ?_:߿`뼒;sgi?.\5k-_ , yK`;C[Y}/լ"iaȢoaF/#'`CШڮF3=JL)~fc,^$y ܏%,O(Gmk5 3I4` r:5fw[@@Ns乙@t?Q W˧."Vuӕv_y$Eaqǂ@DyyE?sﭘ.$+GY}44=7=yo Ƭg - <,@T]3Co_!psL~\y#Ԭ]0)ۥ$" #_cH닦1+voɵ AjvG^2x=:s??$@Pǚxf:&!!A,15c@KoH)5_jId"; tk-hۛ?-;hG)Y=CSel~y^6c""'fIohB6O)*iPz{:K{CX袴#O~yp6 毤!^S2Y(xL3K%[[_W7W[k[idQU SD&bis%*zdZb٨[eUpGj W#vdXKS$@Nܛ`]EoH3!Pm%zW а)F60/R=H?wC ?#O#upgvX |B+}%l'MCN/ڸ>o"/hѽدr+5

w#ma~#`p~mfI L9}.6w'!V۩'1 9=U u=%k)'-5>mqny<Wy57kt<,ҢgTsæqCʟ9y3=X2P@@}'a%vyt![^5mcԸ:bݠtJ}8c1 6U$s#(4f܏[Oe=AkcuA֭혒UޏmBn]`FX֠5mۣCrSŨ!34J$l|EpC,lѫwӘKyRf^VL@jzo1ژֿ)##vw:6םx$flcadž__j2wAQGV ;=Nd%ʞ} tHE@S-(3LjYO?h|_LQu~Q$i(YT?f@~7lmmZ3_(Vgk7kڕ|T :iCц]k[}Hs&?.8{_GQ[6yI #:{~BGtJZkGdRgojk <# &[}7g`+.u"oq]j~My7W ˫;a$zT? H +#DCwnA>y"wx c?\|:%ƖBIl+kҙ:m[wF5x[ǕI=yHW8̿zk}85݇iS(#cun`w^+hxbCH8aup3L~g#3Ah;ޟ,e홅E탑> :p7yGs1RneÐo+SGfOMWzO#v.zd(s>U#oflF<(S?> X#Ͻ/1^]][~\%[Tz]Me3FOq6 :CN"Q6 |A1q6 ޤ-[H=2dA$Rշ;҆0r/5S?V|.P~9CCjL1^_86C_q QѢG2FJrGQɅIBTQ|*:?Z/t-`eTNbԷrKCU@ jve#mb&Ez0fx0rGL svRP*M=ucЦ|4h2KHrp__yOϚx7*G6-ˆ/׿ȟ+EiP\K9q!S3]^{w9t"TV;`>&oጎ9LК}3W$ѯjX%;q#3[ Z,2:~(:5 W?FA6[5]Y'W,ī3*#%f-D8D+LK_REE)JmY-޷oD SƂ4# KceO=I*|i_ $KvR27e-G1;_Q%[&)3Ԩ?v6'Fz^KYR<.E?чjZeؤD aM22Jc攣kƷt<­GM@e$A,HeGd "z7ՠU( Qui@u˒c Tm2vScOWE%3D~.cӜc-tˉb;%nd~jUNƹDA5oz~qB;^}8Zv{u{ I~(X26ێ™? Yt'˼^`QSkuldhA9VјϾ$S8}0cL8ڭjn0GUswD]NGU;g_1vDiXLŒV{]_a` aBG"qIm$CHV-sZĪ=< Pԯ#Cwg3ǘ Rb/JZܯuy?DYj_'.ܕ[eyC[ ~i[Cj na{o]y-<*|Fh0D8r1=;ҴHM!q1CC|[mb`%[ܙ EQUE;#y*/ߠtO ?jG f?] o)OeË鈡_O"/H'.ePćjg~*S/-Gge֛ ]_Y[9 ݔE'H6N6_FIA\dOJГAJAw笿+&Tx|qOىNaVrg2ɴ:s'|'[~+e?s'D_Mwu~QY_+C4D "J/ϮqG 26l{tИ8\/-a%p>8פkZ裞Q ky(L偔HF(5ULx*efNLq[,y'"8y'&8dLBLP mxȳ r0V\x8)Ic6 )+@03UUp)?ثAvV*B6[Lت͊^VCb뗊6!\ePb-P3t8BQq?3-9=4w$>%->)^d6Q#5Pi cǧl躌{ $@WSɎۺАGÐ"iŵSPk ЌD*찡PgO\G*j{UDAG5EGX(mhیr9^!I(kci!R L%<@̫J#zw_W!j<'m2 霧j >H J_n(Q0k N 3]$gڲ)ڕϝ~~2-Q$uJ=/kaTirkAϗMNЈl4C)ⲕ)=DSɤ35 ,JO (GJ3*fs1͏_t~zy~XkWUM\yڕyqGHH`sf%̐3*qlDž|P7;hĶXZP;k:@6LvtsvD P~턚d {eYтP*+ AtRI9]AbKzŗk8*zjz2B(+l#&rIqVA G ;,g{X* 2B[hdž4f; ݟHn8|@ևr+ di`צ'B{S-CrˌMHBȭH޻ceژM)jt5mޟ'{aD3NEj<ϮLŤ0RMF`HT|2mr5ߧl8j}="X$=}cjje46sp \#Xo-HR!SAM\l"!(Y'zEv:q6bAx5xm>?,Cb+#b"$\.)hM~mayxjFd \xk{P_-_Bi i.NQTx s>LU kP7SEjn;{ȘdTׯ|8@yV:#vʍj>_ԣqI|g-hǮ\vx"L~$AxfX2Y yN[J-& 2͟avnΐ kjSL/n&7Ӹ%F[iI-Lac7%ƽFyh^Vъ9X3 ",|_zG.?@H{}s\Dj u헷lָdí0Lev4`!vl-ԙgc #Jy2 q2 4g1oҭ'/Gmm+Q>iZri6T"Jy~/b7t4 ;D?n[UNg֤R7X)DLX1wF;hNnqSZN>pob(+V@p1b5۶j;GNuWus$޶??0|s->ZӞ; hqzDڪzm7W%> 1q2 lGC>|ִ[y45$/hHd빒Q0I'8%ͦ  H~#=91f:J ԁ~yy(n ~ [{FPPXm۾yvN/bCv70MgDE)&CO"׎>~H_ϑܾ/ȵcD߯h7zNQKmN=pX91߾f = '$+ӷk+1㻎o3 Dj7=Mj蘇1sJ&ŻPdE0EVTHzsˎy4JTzv§h;ޢVOQٿU15qQL"Y!URKTxzaxC~HֹO/?=yCr ^od{/18cw}}i/3,M欢㕭Q{|yK5+5yY$F=hxxI|i?|2}RJID!G3YROltmm^yFZSJ6~.˜B.-SޟurLw;6bűN:>%xgqYA'c@[ Ԛ&z׊4*w4_§1e3%D gUSETQq':)%yᏔݸ)M:܌߼#n=g&G[͇=#ь\9Ez{Z"zc㘘F&[SHbkO nAڽr-kS]'I$|7BhEC:2\Yl!Hշ(LV٘~YTS|i$~Hc9f8ݢd / $); =uZC[@mX &'V>lP$_$C41^y~6|]S:MwgXCPiḘ{C)޴ D(2[= țnqxc&~[MU9A}RX&dFu !sKo)+H5rzqn^7pS*(GQu>!8& `h9<~Ppeҍp]ЉuQ,{ae/Rw'1 ΓЌZ!٤maC%G5͜Im oRفCN(Kvf<1j.TNF(QvijI)t)3#S|^rL[vxH p $ aXeIBQ pU}(ݑuHBjL#mj50nGDžnʰ]ڸh&ʁF{ю<ݦy$ӧY.-H:28چ7kGʬpW㝭γfg,rjB_`YDZdaBcb@p}ΚҚvjWQnzXoCO0rCP7ϛ?15?|u,%1;I $Y oME7SnK{P8sxε~t~cK^NMMQG ]Y~>3lٽCxsS[:a5ŬB~G!Z?楝ͪXT:'3ŮMI=߷+u-;[qYe` T23@W7C%䈢Fw I[xu~Ώk]7JPN.o{7me^KM}pxS5?3L7hҬ͒SB+9mlBڨ}2?9;,ɰ{ofO?/Ko0^k6Fei V$u%gAZ;}?)H|K}#J{*+BnR>`.6#«3˚ƍCRb?wLǩ`2_q%L?0O&y{"[.E~VA;)`y kz+t?Nl{I 8sƼ=Nlб[~}kS".KmWF&?c;0 5DDw6G2Z#<edH tc C$||eriS*9̈q (pm T#6Z|,8^tzc|ǟWI/n%.!j/,l{beU:FMZ x卺_ L㙨d/?ckDtH YGto2]GTK?&vj6>;;BOpyz7S1{au[|t_qHuN> p;$Fq!V:6F \VWy'Pª❿o0eHߤ>?<Uk6na}Đqt>̢KO c$_a\A憣QG&P5ؑI8~yo6hxcҙwu*S]Jl'f5' $ v:pb \݊ѷ$T;9T{5dB">SThhr =u#:1:"2 בoa@27<~HΚtJ-+&37Ҫk|'zMoC 8');;•9佩e)rߗ=5̓."C;sB5b ;"e(eU3W޹m5HLInsWJJn߫5Si]̿0]ͫ\}U' SVܘ#^ o+|*H#EB[W6cY% M٥fU4l H,Wj܎܀ܟ\ 9F'oDG36j*ӞK$vw;Mj|2[luk#q P9јCJ tGSը}d˒eJa'j|K3tVN(@,v q[,:O#Gӑ8v8q:Loa Ub:Tͷrcou>ѧ/;H> ~o1M䕗w9qGJݸMu!iFsPέ"hms>gdѣs^UQmvf?hq;B=3#ę$eB Heԣֵ. HL 6 gcHMmH.9-H*vf&Pg1;F4 88&eyXo5f!)l5hޜLaiНw(wkP 24X4zdjdG6vbCБ=o>\lVke)^C 0MMra/m5(>΍U 5=׶gFq*x\2_3۸E*$K M֗ZNLQl_Da.b[zmm4lCU^ H]b0JVz}Z @xB_]^ELQd/ί,V2*~mdvRxትCK<Q8t2Bw͍j<3ZHlµz l+ ޡdڵيWDi YS@Q}zu4YC#N\;G?[9Аġn4 6·jV9=Tb=~BrK ִ2wY;+N; kha3U|ryuR$DP,\fY|!<Ѧy{[׵ gSUk!n D-7PqsN#MxNG(=d+JP}.&ymt=8<\~GoZŸRZyN-i@@(s]~#%Z'!:-K$~ |5y~9:-_c,n>}̛[i52ئٹy-E%]-BׯߑƳ}SUֲjsSHݏ>b=ǽN 5%u_X؃tmϭdޥޞesyʾeQ.t SшI`T,'4˟r99"GqhV_DOw3ԃZ#b̀wvDF߉W>[֕Ў5;n=3ΟX67F_b4R:[7  ^wA 8o6sw+gqO# 8/ZE%ak{iDs.HMCWd0E9g`b7̽S 09" H6I9 +o-Vɯkϧ7ڛxI_;ν]sk^2\dcֿdlva&S>|W=ͩϊòe(Z?ּG_(H z濕~mit-4rs@ОM O2йDdN $%r?kɻ? GT?12Į5i="̒><6/`| H@ꖰB SOd>9{ ymӯv=[G1R7t&? F7W 6LhU֯uA%(bR{?^U2dDER!%.HUTu$o+~Yh?Okq׼rXj-; 6]Th}@xcRO9Q̞H70N8|Ɠ8x𧍾9|F&'"wP `~[䩏m\_3b«yxeCU͊hVebf[㗊vl!V^L*LPeJn3"Jg^g$X?ꟾ/ؽZ~U䢔>9eq R/222li!z`@ސ(-t5CM0LN'o LE#DJTS_ ʎ^!-\"$85/QJ6) QNRqa)Pef;(4 |=g,,ۺ%EW#Gxe׷|2MeT׮<"2DGs g>ז:Wf3M{eq`3c.J#g:a/J1WJ:cyi?f!C7?5m֯uZX-";-z|YbeƍdFפH.w|Ffly1PǤQC+i~\zYV8 J5j5#hw˛7 ~eխtI,FI}rH3yMRSzqxRñzagyJΣhE+Wn>D^UITzʝr?^JA 8܈e]m}yF$|\N`F`p[~cmҿ<@Gmgsv ?zGNN,2:d(7Ӑ0T1nJNT>Y)n6@AUU"BT w`[D/f;{wɅp==S/F=R`u"W\m&Vr8C$.|j%QNM??FZ%b)Yc;aDh~ "NoHldy"=zTw'$@ܝ!Z7Y-@ WSq[q2 >8MP[v7)NA^p)BўԵ!kD,EiJ|s [c~㗕/x[y(5K!~cѭndېH@+kD[< Afݎ&L&^&ttx_p,Z1~BX/>;}b#wAEvΞ+ sv5pؘj6h.Z~G~Zl]z>$Ml==K K7_71v&JjǟV/Tf:Eҡ"j|`}sLnsS `!Llg_HGiv#$XE (`ȈAW/jh\"^n}rFw+NCjk uhH>'@HWAe%п<3<}j-?T匍p/,.;Jzqʑůއ|I[܎!y;tH=M#F<q'枇Gpn.ŕĴ p8׸O\MrϢr> ¿raf`gFҍ)Lfqr<^s62? Ď|ݼ=ߏFOCz;ǿўb\z[`$\W 5|>˜m)_/7c؀Ty GdŤVT<~m1˯<^ Kts :$U*j@6vJQ57VRZ7> hh  ]Rdy1Q^a&AC2(#%rENr=ih>JX#඄z(ݙ].BA{_dGc‡YhS; FUb3Hw4@- O2u>3AͮΫonvWu)z_nٰ22毬L?Iz}-Q+w~u9bsQ+CBNt}?&ۖw ;j6h_Ѡ+5c`ϫU9xS`>__լd?nR7tIڝO1w=~cT1Px~yW0Zy^=ᱎ(jmPMֈXGM6潪Oa9H=^/M! I7f<ڭ[ywWte߈;"Vv2Hwf>Wdˆ#a]d` ItZH*$kMيw¸nO~;~r3JgA'|!P+ {|16"?ZE27c_ aDdrhryrc3k}GLź}4^D]x*{WvI6qTGdZ-4^O59cxT|k Ʀ 34ߍ\ "QQ#{ye`E=WN[Jj!d:t`-PímDJqD(o%׏Ӈv ިB;li PLԬ'Qݾ&@g̰-MՑD MTg&bQd(4'!' ˻Ͻ=cqkC_PոJ^E T_a$De@b{ir ?6h7&۬r hazt>NL#< M(Z V3IxJFxHЀj7ؑ. qz(ˉ5osA+s2|1c2)_^QnuzW^ IBG^Zܞ3kRO!g GQOQ^wR?tIؐ8o{{3U98Em*7on.t-CFҡM/ظ1$U\|G~Wnu5Gi""n4N]:255)V61Z@9ؼyBwi2lʔUP7 W1m>5rb({{g#ԐkszQQ؃y=qIխ|w&[OBVDvP @ftXĞ XRWmU:|;7 %t>^.fGlAԧ\]Ly::W6S|@~EƟ}f) rcP*NA ¶*+|G`״bEbR϶up;9p~&2fG6i=@7Kn Aۚ) q<*=yp喌&S 7D$~,3:?Y$?s@v%eǻm*-Q G@R~3I=c>;m8ѦCCR¯5 >h~ïx;\.j8l4|D|A;(3;J'ȏ׷/4z|Kwz? *kM)rS)m }1۟9v2P|i9YE{&6ڋ4Бj}#aG;C|4qQov=Ab!|_Jo";^)6$4vmS6cZ% mp=hS50d̑7D{v>AzOO68 /̿){ ȓ N^<_bT=^;k0GwO2(Cg) K4@CO wJ?^c>XO,xi+p֣_N=1_oyQ%Rር *gɽxsv^/}G !/2qyYaf{`Soqoeg8ehMm1sAoƁ{f 1ݹ'o͛i:G)&[sJF@6<)ܴ3/d "/4O3ޓZ_񗨉zdrW5u̱٥0b |zv Z9:liWolb ~K+i2+W9֕16Z7L!ݖsQDSɩF%V5#%]I.r8I=PU>yJJOol[F]yW\K| 3SoRYP+1]~6^y$Yg[ >ǯj#zfl0y kH!p/or[,hHZ8rh7]?u;g0 F5}\ǹuaIY4u)7p8qt3 ɧ eBF/F{-|(^&E0)6|d4.h2F` ug ׁFH؜~ptjâ)ALnCIþk9ebg!.uFCm`S&RX_Du0s~ͥ5⿪PlV69#ϛi{d>6nh-䣧zz\yJGj٧V rsg&{)ʊր~na&5馀躦bdr{WJGP';odV kydGc>3iT:s%ą IDŽp;Crgw7-bXT E:di#G2_MQ\\,8F@cR|5Bâϟ&mvއA|Oa}Hr<34Q4U!Н |5D,M9IJL`y3f$7sl𪅎!F/{}ù=rw^9=!U#_a0h!Ur9={cZ`i%ɣ<^ :ȟ'sJbw++׹P0[rmvey&ۆLK,d; B}`/͈F-j-&k~<_NHM"$ZEn OL9z}Lu!&\zH$:ck6,jvO&q:.EbIi*R})i]=wja{lNNcyӿk္Bi:E6֬v$  ou]E-Q("V: ;S>Fb?/$/3 7fΧ {_Hћteɹ?+ntMlJ|1TTs`fKc=gVww |%M aC_ 暬<+$\FiUK ӧ\ǐo<6cJmnk^10G@نb8^6󾧧Kf=^2c3%3Z>Dm0FP֫Pc_c%* !ҟ`y!W'%OEDqT쪍Yٰ,by7;dec#ۋy Cn/ n* T=3kELAӠ/MB,3?$ oG=g8L!;GyJ:j-D@OW`f+ND/a$rӼ>\myaY{LqC=fvC{G*?ZaN J[)坼?fQ׬2q@'Osފ=$N)soO/}> aK _+0پ+y6WbӀ8MEsp1[0he%,W/)qlXxᛞG9|_S_,<)u_,<+cŘ~p36UrgWb=گ^xfaVb‡f[lUi6)LءٱWf]vl!V^L*LPeJ^2!*GԼ~ iZv9??|^?۟3aI)sB>yn׉Vbr@(Aң<4KHҝ"#uYݳѩҝBןuп:և4c#y y?5i~,0̏_8_}Z9_ n.W~7fVKឤ죲NQZ|effî#O'ڤ1ڴ^3%J֧2 s,ɾY5GIߎBWZ.no7y6!iEA~*Z KMw0J!~F6lvY I" s#uz?铪٦6VH#1MkYs`JBd{WI*z< ooolAʵٞQq %A$vwn(M0ɿEڎISRvpk#aځZ(E.C}(n%}+ۿ8¤l(z̊sZ`>%W#[55K+ҢFJ$zfq1:sf% -O>PG Fqb$<"6Qt{h#8bOگSmG4@@\<4 m_lK(R>`ehA_sf_FknNH}vfDM|[e K_f9nэ[>W**;SW(L$Nv^Uc"+%P:Jq1`ɯleKƨV<{{e5}NExԡ͢4U+tiSZ|KlvHb] c´ew<Ԃ~y0B7Gv猭zl(7&o˫]=1F<ȭiu5|˿ʽ3m(ʏJR9{g@ IUj ^VPdv`yuGO\F4/&0%xL XMᝏ >>dx ?h BI/_[|j0ݸ7"JHe?f7ev4jۜƛ3鏦fvgh /gWYzBmu#}/H8O=zqDٛUbO9= oW]Fޏ4ލ^JK,o,Cݣf`?Q|kE;2; '.&6*#o6's#nOҖ| W>t[s}zO&~7<2`gFҍJjsYW}7*3x%*U?l y1 ?_'oP3z.р סWIk5j0 i3Œ& CKz{ *Uu՝ǧibyYf/b}ۺ\r^Gayq]u}KBZN}7< 0@ond`- )?m@ R>yjѴg01~2j*̸ LQۗ_$$USs@UrO\McRih#QQ9vJsNVAW!8{,zD~Uu1yrK_ ۳jc"'4?9{}'Z<#b1G8NMިM#kƿ~yiWvǕIIMǧ1Cgv-!O@^i| iD"W¹7A3&"Dp)SVZVSfFf_pgXiȰNWM72A] aG[H%܅"96݀ KX-,"BcDRA$彧95\Z&LIDG6qטnQ$AzlkL3rwbBؒsP}s'pb8#7c6 "2VkpƀԚ ^RipSR;}W1r Hh($`\DiEI,z #NZXKGSzq*NhS̼xevt<#u-Nx2$M栖Z j Gwqʪcڻ{Wb.[)$Dy'7~]-7ܞ”;bJ,5^r8KZǨT"Mtxb iQ\Pp5fߡ^ TVApxB;d\X S! TmJm2I*GQZK!ri-8 ^" ~Au3}Ȯ IwEBE"u ;*?u&6c-CXo ×ZDң1Ndgvxo 8*=͖{ۋiڅHa70B;o]v`be/TrwR;1o3HRm4ȧM'S 5 ֟!eɴDD+zcГܵR* @\dvZKB_DWrvn`ӗ/U]Ļr64 ?F(憻gCn*(xጨۛؼ3"QC{ar Q.!͑ڞoyfPAК#%YU/ZtۧJ8#Ztk$mPA'm 6]@IIpjzyx3DP*g T7c)4~곫T2T&\Ӟ=f"K:2WiZu;--X +h6C_W >MrܓP?(un3wViB+|iO-ZNMT2 [$U;5HQ:e_̲B6w!޵>9⽹qeVJs_$Z{ A0Bׯ8+O#_5y`)brO6rf/SMD,hĝ, {xS;$+0!TlInC?v7 y-/u) hɌLlڑkOp7Nk# bGBtݵ)ᗦ]_|³h5WSAhh"ws/%Y~VMy;.}?Ccq*I׉ VɅGѵJCb}kZ}#O"Gz{D=CMZt/k I_)C Uxc$ZVUA19"?UC+>aV)-u$V)Pb~itk 8q4vm;&ye#auyɶym:e$G"t7g=ߤ>1P~kLV :he`();e 38@89%Ҡ-$rִȝ ӓX @\Z)&\ %]Ioiiͣ<* 1.',o0 Pzȵm uc Q)JPZjiIYiKէQWr[1")GƘ0Y8 1D'^#WIv EaRL--Z~`r> "eHR5<\?#zM`dwp4!VEPM$,ܪ=h73k =JPx168Cg^SGnR*R(yl>_pKwh OaR&O{v68a0(s|1ּyzGao9YZ>4aQO 9o=ߙ˧1" KHe>E5cqzG}K$8}8ſބ Zݤ٫Q#MzvʫӟbyO]j)).Y"ct&gpyIjVzL WW[͒cqZ}*C'w?C=w\rLHG\=]W8;_yW-;nn[v!9/Rszd?6fk6pRU" ?/x,te:S|{ƣwrkԸCm m*D15۫%ɣhX 1|I8㞦`T̰æY?2l~ܳz%c@F>xk?ˢI1#viG57f{:0S~3qJ4z."" |yt'wkZ|kq䴓)`ƽyߞWQܐG@:|q#}Oe=VWvE>"QM}l\,n 9a֗H81qysg[6D`~1X_Tg2|XQl0;>PCYkċH`r"~G7|_7,<(ww,4&僆bbln ɰEiBLc@mjLm& . 7?^2Wf[^7Lثt͊͊Vu]vlUٱWfkeT4˂Pt8~ÿ"'˪7K2ga| 5EY(h#I*|"yPv93to5.ϟgnތ )9ix[)(kL+6eYeg?S4Xm㌋s[̰~g(C_nijt:%震ȧhQR>`$_6x7S4Hgu=(AMNJYi}]<%V7bђN?Q$7A"Ml?-qnVdj?{x'GC"(Z2H@:xz_7^`jn#5'L_#?c춻Ն_Je:ў~NJ`6x?5%|=r<}:̝ՎCTjњMN/IG,-IU%˔8 CV0qC`F< ({w;@ROM>$ ASFv=@|}&,X6F W ̮#oLCʇ}.R#d5bTct9_/ҝ·+.dQmƞ,( KR?jb IZt}ĥj8bmQØ~Oo6kmsM:|MoB4>dsg'B,I[qI״VT]RǪGK@j{%UZ6=Ηz26NFl0<͕ST=0 30=H_`,8-=P$jA]kWƙd}#z L|ʻؓ}"ƀoޟFTC  d |pP/ UOLMhIGGS%{8%fE:JP@rGouA4onjcO|Di~ۥ78u] W* iAh56%-tx-E714.-M 7$h2 cOf6Pb{D^钝Nd^mA> v?‡&#!FL >4͈~vFQ'f"A ҴN}`PĖ,7Z`!e$0&זS7;V ɥ+޴2"4iH"&ÿ-F B *F]w+,b&L{2|azv#-FZzOc޸UckHmlN#z6?e @l;}F 8CūUe\qU\lnDӆ2h9p /3r%\ /vUejk0b|mv-٬6^#dQlh$zon87c-U>M ʭWSx _nz`=,81QN)nx]e^gu9(SwP~*W~OҼyMOX ;#rbL#XI{} =I=)5'6McKw7i96Fwi*ƽk5վ%>xO&"G?J?wO1Io8Il^WNӭlIc-7/wu]MsDQ)rqCɆ_c4v~YR x׊VVRkBL4t&\Km @'Q3/L8+r 98DJ[ܚOo&L^dI rZBEGRU7ZuKGfRYz]he.φbvx~gv$@c=%O>O?;=|!j'[:Dy!;U\!Q:=s8u ?g tr3w(<9Kuf?/:t˟g#7C9Sc?J(뿈ʞC.=F @:K\#'_z,_SEnVŧKRAwE>_o#3){fO 4|Q-O7E*iq5]B)_O2ܧfrCߵZ"B;{|OKpa ‹+Y.lD`GJ/u8o[F٤$q9F|q `П؍g5N6iq۫A^) |EN|v/'1\Jdn4 Oίb>eCP+U W'AZ2z~fV#@XSK(I/~9jmE:-jL "V]Cߗs)Hm١6֒W[Wk4>RF;P?x dmpq7QR0D9G$wy; 9(V8[`O^:ض@szMyv4.+↍ȓ(lHRHRS}YhTd0`b[iߛ55n"*zt?'͘ꙭ (eBWuąh_ ɟѳ{zzSe; .XJڞ9#YabT 2*!<ٴ'k{eٍ(M*|-7o)lݑC}mkFUD4dSu2ьxb ? O>u Qz̜@t6{K<77qQH zL#5Jm3(˗=qz]2&v[ o]s?ks]D 74oq1;\q=>m0~csqc[{23 N)"6=yW˞kJa-D4F):g+DN~Er4y"?1j6D½EEA)s>U!Duڶj`#8 ccጺ>\>_ЕkpĠ45ۦC?dr/aǃĘgWс(Ϊ"[D3maiDYHն]U_'D2^!#CUnL6GS~+L!~><=vn8~~U,ji}Hk^HQV mr7cR6 Y(~YC3]N8-6Hi݊,X9n&LŻزmrb{G|RyF;o+ĥS>zV(ӟnj՘2G-6 <ͨE>p륷 nj|>Y}Az`_=EQ]nZۅeR)5(zIi(㿛_gS+6ʡDLXPoW5/M _ٽ[\]B'Yw\򯟘Kzڃ15R 6v)Djz0'#ZVPx28 ڹUPň],;z͵O:S5rX],ƝZ1aZр#4ڿ+N0 Zgð'lC (-&v>5(=K„S @PW|ZYm@U١0˅7QRW̘ʖT9W?l\1l,\OJQ[Z|)G Ƕmr'hwh%Tw (T:+0 Ÿ#}N8oo)T}E']]S0cvPm(FvO{24G޽pk=쯽܁ 24Z$T;e,)!R6p\@Q&>; ZIzᵂBA3z^Wek`*kS1HWub/?7c n T´z1 3߲Y?XǦlxqř g[(9ފ3|㞔O)AmjIāTƿ~s5NY wz8j+ϡ~U[Z|\o&{{k5p\#>BwVW3>tO~ک)"2>ښR#$A\H>?sQM&˓X궁d@Gun,>Y )l[EzV+yH>82Z;?*gI⏍W!/\6//xFmnٮԵޙ7Vn Ԣ7^tia> 1!jc@݈`\媞R3|gpc+r|w^yk{ͬܲM;J]aR9L斕{<0TKu@^AZg,\OzCz>R<-EUy/JkZ 7eA$"qkGhvmD>8C|Lpi(tuksJ,>ݵzI 2C8&>gAoaN٪SX?ST-&յy㶳B+DQԒs׾^&E|ZBM~53=Murx zD}R=c*[2нƱ5"uc==Vg|!}Qaw.@B^##) 81:◼ɚY19|_~dJ|p /E@DڐR'[vLcF볬鲏b:*(~Y80{H?keÌ{@:nJԬ}w=sߜ}:ϕhTr|g}<}dz{KŠ(-E$agG/u~{ :mɁXe#rFjUH=36~u{kYpdUu 4aBNxvdw1|l m~@lx/ˉ/c{>aMZ> DZs2֠Il?V__T̟c' e*y+_Z3s4VXl80, :j2`$yoi=fMc~GjVÈcnMv|fa%Z|Ldq!x-R=Hl06nA|>n8{xf\G?P7_hZGdj+A򖹦P~NEZc,yS>8KOYOf],CmtJX dA 8 zȾ{)ik'`?~'"WAc rރf; :F^2E)mwj^G1=G/N6`ÏP;7wuWB ` iHN&d+*A<|el*i Y)'jxmTk<(Iܟjxegv"F^Ta=m"ثP?VBBcUSp^KZIt@6͵\>\U(36 vX^S`A鈋di,UQeyw=!u ~yIw1Q2$ |C24@R]^RIm&du iaףsruد60 i`Yb }>r"Ϳh^h|ڂ1l7?<0|O:]$@"7. pѯ>asi 1j{2LOV=JnY#1̼]O6=\0*,XS&Rߘ&bhcDJO:L1 >yPf[[sJGZw'lɷ[mX#qQ$U;4ׇP2y1#v+iI+<;m{ĩ{q͡Gm  ĝŐ'i8e)e5Zj?F#@փ82!|=E)\1 S)Az@zԢ۠k$2!果wN$#ey*ޖ O7NTSvM%72jw} k>J7s{j:Gq9:)~^8[:'d:EfK<F]Ndh0iFq}c}BQzRՙ7:|mwa,լˆ!ݫ4ȅ>0)R3kPgt})E+Q#oׯu}-d Ud7o#;Q~X~FߗX'T46ݵҭ(V1aAʝI9Z6#:0]4{&$&MjV6/I"@>iPgZFΑӾj8yѳ_憎Ϗ?>mc ?>Px:#=@=G? ¥'U͆ ! `Ȟ"&D=l"cAW D$"]=Vzdz uY 9G) ?h2M2#Qێg"9eO`8(L(+i"hxe<'kq#O= 6 VIDM_3$5rbv RC! mjZ|1 $aJ4C㽱hDȋ4{7þz5yDطO{ `>9\SRҐ)P9$eۖ]Or`Oުc* AN™kɤGS,x'*ؒ"קLKޕ1D*qN[Lp:S;te'ȩ`"II *86$K mZU ɏ^`(sC,`h:NZl/kCS{o"h+Q!Xǡ;8'8¹nش*YyV>?FH IA_Jj-u ,D"6h O%iJȋ4o0Upd2P*HD_o*KZmAޕ+0Wjwa`BDzԉKTЩS'= _(Y-}!%k;Sv,}Kv#"(Xە;q~#g$W__`v:Ӗ _Ub@9a4UE6*$fx9Lt?\~Kt'|3΁\=Agy}; Hܦe&`G쑜el`;!9yxynDws˺^f0Dv ;SpGLמictp:-f z ##оv}j:4vwvU~?|w.{m}ӞԮ Q87E>WԴ>Ȑ7/IjP3ԍc_-~`X̖R#e3*JЏ !G1?>4fδ )'T)"|Cq^/s'JN~#0Ŵz+#`.PYiJ@eI8gҝ:t91ODq_(hm%ݪzNU\$V'a5ƥj1V^i؟o\ (u5|0}VIgxme)lViQ2 jeqҬVKKc$3]>$WI8Yjq%< }58އeŴaO4o&hQ *>B9,pC}NQiO-t0pzv0Hxq'3Dr_德櫥miЄyty$IG]S&vqlf/ ]>UF@&5G ?MVW>dIӢk5/%I:u 6LWYxH!C9flh?{~I12"MȏHt?>yƵ #Z g!i2/sbw3.D5ؒk.m 8dr0ƺ^Y*>|WJDR!n}Vzm2Iƭ;i Lђ e{E'b~x?;f`P\@n)ųDTS:f| J%4)X>v>J= ߂;kHpv/4GS1kk"/g+#^׾OA@h>"r@n,ll/S%Jbl!Z16f_-4cc|G 2-}e;u`T盼zv_ԍ~".(G9I@G_G7v49dJ 'U_rQy*_ֹ]!})pM@o Ɣᆐ\wɴKJW q8  +],x[qN$;Axƽ ujB*WmeR.P67[(gc;})VA490 3$ØUT j={%kf7&c:٢Ec\l}|ɯL}'`NDͩ*W U;ӦŸ,@ХBtmJJ;Rbl]-yGN8xmaOm vrچQXD&0L%ېj;׀D#)a=y gKT7^4=#Q`b\u=?XRJ1mL+LE(HO|\K܊흣,:GVb:M*8_ ]vo!2VӼ lC kB7 vBJwoww9y$ M>glEzG'H/L Ђ:x|-mԵk9^-:¿Snq@Χ~G>WY5S1#qꆜB;qw<Oro*\!SJGywRMd־GW:'WK^dZ-#mI 33mL8៳2??щ?דDtpԎ,ЄIW|!ojWNl|+.b)rJi4k)4[}p;m93عG:Skp802Ӛ?'c<:W nz=uKxAMTZSHԧrŸ_-!l @̒3Gq/΢C,:@9 ÿ'ujځN61"Hx_^~~iMy}/VnG2"-P7vzЏlyet#J_6 KXw1]h zXEH?,m_O0~l\OK'tXݦozroOӜ}DtÇ@9 =R?/Oxu-^v[>k6DemWzDzBxTi+P's1ބ<!M@gF|l?h}6"4B9~Uǥ  ^m)#.;eڄdpy{[/T\cs#Kht-1K;FT;A y:/N ҚQF?ݕX#7t,zXpc?ߪP^-./.yJ;;Fݏvv{k0bkݙo~My}{˗ &w6yfǪ?7O\n%w)IQ\~GWTa2_]y_tO&I^/M`2H{[.^a}_ʍN;bΜs9}e% #7ȲѱY&UŖ<-T&Dk(-ƴ,#m b0[`\A m_ %cZ[ 7\P& moˁ&.Q¸؅7ŠTVvlUٱCb–KP6(vlUٱWf]U04ˢtcLxELfB3;cƇ3Cs6|sqzvg9}fA9kiba+PS5B O݆g9Tꃱ!T%rȚ ZW, v- ]Bj22!a, =L`tCG]W@ )@kyZu\ŎԡH#z\(tJ:Fa!4POδ|Ck֫rPfd)lCҢק$-7l΀7aL$ etmVk`R)Zp Mx+-<$]K ARDj\܎#d`%Tޕ4=2c*%ںEnR뀵npC{ $c!O`{"=R m5Ԭj}%El&>'1Bss2jL`$:qwW}\yj"R/̏<>y:-iq}vy!P"VikNmJrLwRoKd I5=ܵ( gs[ L̽F"Lq>٤OMp2o.W_ƽEK&KLV6sm;ezzkQ<֙ůn$u {1>':P#@tN l9>쬣HmPUP(tHMJ#tl-%E:Nǎ}vJ{ZhZ@b}3Y182~X|C_rHGVHvQ`yL';QЍ>m4~|g$g/|.As:~?5.^l|;&amGQD =3,B13 [znO2yK̞B܍Ǯi` ՎNs;i9y_ϳ>ާ 7M>;qyA^)f#0k䇭 ~.ky.ۭy.QDa$S.y~E;/$\6,Ϩ2 #Q^z'^˴ ȿݷ ӓ~ b/ᔺ?ay~x*C&M=bԆO%Mw$I;w$pM;^Sk-ѳiGq\q&g.)o<}(Ϗ?n/5{WV|tˆO20Dw٬F>mr?~MYrO/ꪑ>x&JӢ>nvsg'a`pc;qyu'J) ~93J  SM[9 (:iqW{茇*נZܬHyzEE:xfS+@;zrɻJH<-gPk 6'9UlOZflg僽Di6Qea_M"+%iĻ/_|=ز_2hT6A+ 2-dQݘ 9VrZAtv1 ynVPJGfnl'ae$1U12 $M޽@<LtOXU̸eژ^ۮ,ejeKlqbv}|qݽS!aw"~N` #;Z)ǧ\2 &QX`-nH\Kf#Ek)Ҥddo?c/19$ >=r&dV5Ҿ(q=X vd 1ӈ*A=F7<)1b6^5߶f$ .cN߽z|9$ ;[x TTŒcx _sj r iQriȁ5{ߊ$wg,*$ {>&N_A39G2j>cF<^>Tܷv=g{T #96o.oJH9#b9?>4 ̑/so6J3s^&)i=}H?}>dO}p,q`:o힓OPc+ANS)-c`xb{vغT"PX_[oi4hњiZzHkz|9-+([EZƛgr;42L 4tX-ܓ|k=VCq D]>o~b^yB˾QH|]6(N< ¹WoȎ&FeW>'-iF\{gcܝ/ԛ~_~^Y]=ޯv}]OQ{%e^aB5=fx+˳7zY e//]nccq{RjyGNUEh@?t_p qon!KM $˲rLcd7G$W~Lԣ7Wڏ}Y!ઁѤ@DDqkR@F6sڻ#k^O_d .ӿ0?>omn-iq%N[bj@jޣ:ei /:t%Eq y9>VADñO+梳~GWU$, D+-N/^NG9=ڣ;C;tFCbk-N*B;l|zZSH L\]}EE qѲ2gC_ ^2k/8ONA";G *h$Pݛ}υX7<~hG|FLP;W!ƨ*Ą.P:X;T.e[SM!kcؚ'C~0!see(pF%c[!}NQ"B9Lcr+S"=䦒?X7s?p98U󝅗<QC7UfcGSe@ԙD:KK1-h呪iZz7'a7ڟ ."K 4YnN~w_5x.LFO_$eϿߚzW;kg Y&G";WdJwΕ/5hW-cW1jO _IWWq ) U8Ï$c">8b`wIbږSGsjORd!nm~\L=`5 Ν3"Clէ "ù=g5gbKjȐ$9w:ySsׅ$^.zWXЧ^jC\juwaA}yr9SZ‡}{vyug//m洱%t Wg1W= $|8p`2/ y9K9eos<_Z}kk}a]FnI7$+@j6^qciZ [սXZCӐq@J=S&"`::\=a˼}6AKHeԮ4k\<]=+FEI$T/ii֗a /J74Hxic?Ή~p.R;G9jN1&!Hid"/tTk`zPUਿB3_r^+BfU3{D?;g'h˫K>'c{/ 70]w3qm3GYZ<6c㶷#pZHRfv2;v$V$랪#Cgtn{tpGcPGW0I$vRs{:LW:@FMS|^yԤM`[^-',3~\zyh^0IsቕFh6y"cLlޞS"cES#l5^XL1-`i|TGэo,P& mڮ*#lq qp6,w,pծ1(!x0؅7ŠT?_2b͊LR*|ثYXٱWf]vlUٰZnj*/3Ǐ?zɩ3?h{Ha4=>_>!jƵ9^t/g@ L϶E\,l),ALMH߾)$QvIॷaW\ŝk"Bջu{]2;*3㌕"Fbz; 8E;vv0CB_l~Oj"9m/wB y;zno fddԱz)w^{yle$q܂{#'6%rbTqѵ1-䅩FB7۶MAFV.E*;SLɉeﵰ D^ԉSZxmRiYUN »ex{!I~[~#x I`ROZj yL/hEB [#>8WJISOl*tlOvpKP0bI]̄Co~ylOpK1ͺ Ek oJS iFʓ$"p,VFdda|nN0 !wĜms6!"MҧyMSnE}d%Evc՘EsUr6rz{\r#z|0n۵$꣱-YSZpzZԊxhRYr;`(*ЀzdN^2 vfM0qL||x~[AAPS/P-3}v܊|@TɈ&2KȀ6GJ֘L`^p-.\,b V o:PlHއԮkr=ޫ+s52D}+)-.|xϩ2#p=}eGkh1_-3dӥIP!#nZW.5 h-̞Ɵ=#v ̀yd{Ktx@hnI=^A_wS sO]#7wʖ, UB䕥iƻ9._./…Y$riV%P}i}Sr|h[hnj"7 Ena>umwq{9Kŋ*4OH$0^΁ڽ.pxvv`)m.LjۻP ir͠gYv#ѴZbs (3rwM<ϴZ 58<?h~Uin_a뗳L󐗐oޚom5.%)%1ŷF|0>,c&+4VA4s#n 0*z ~#1^t("g<-! ԁSaF;ؐf{2qm.Wa򹑌c㗁MRyb/Sy+@4?F cn1tw;`d׶<JW%gC&KG@OG,*}Ԓ~8HZ9-jnƢ4+"dO} 4 ~aA ږ<3o}$mI.&RƹQeU@oMkYNǓ S ^Ik xW0ǹÙHzOJ-X:SZҦ,5ҡ6֟YM6Vr^LOL[BWVu-j;xf&ҧ<=\PL xŷr|NF/}s+lي~ޙ}:IFڀ9uHr_CNIڊ^HXKqzۤڻd&vyYOj[/m)]0{lg{zLDhpMzw=3Ĭ(pe:?N T 3 #$<nqiIHi),c2[O7D{^&6ZtQ:w@#vjzVz`-blemV9mD!%O ;eb->[יo10ShN\ڑ]Uz1%'$B]ԂNzѨv 1r6ړ)#n ?ѵ2LJN$?Y3P7$e|5U87ILƎ"76p=>!WVfaҽr!$P:`DJ Q~{XjQ,JoN4'%E't4rl}Xr ,h/&B>74*O]m6}=GWg5jjóxc W~=\W?25ceF[{R: ~oĺ_Q~sk88J?;ݶYDŽ9}_u4rJPm|y^g.BF.Jgzlr4_x~X\ӥ5X Ǐ!PGѾx?oHBJbXP{@Ly޻'b_(3C%ſFx`r'9򯛭RS;2>&110bz|sݗ~}0yr[TtMj>`?' VKxvo5PxryL{}q//_=ycʿG2tP5%Fu>ߧ 9Ed14{)FGcZ(=/]~dhzU;zw Ox,waSL742qbe{ݲo,]6#;5=;`5qJܚy#Z:Z9Vcmk;SCFyxqu8؂ApÎ'tsdVkVXvw0lvm}N}&Y)4u~9mC$99r G2=/9_֙N/hJG?;MpXl~u8 jWINٵikϧw?XY~E3XV['1j8\<Es <څ;Lf/Q:dZQkW2mlaDx%$5)Q|e`v?d vos!*v+y鰧Iv=uĆ6i$m|.6v"E݈6+L5t]႐9.C2n[`?Oo_ˆPb2u,k3yBJܾUJ|Q:][c=+'O2]*ʒOW{3Թ:8rb<鼱^՗n4g.<`08:rCwXs J?5㿳>CNoY>r8Gn7'.& ~DZA'BH |Y(3p>Ve<4FFVPU<3leQۡ7~-$dJLIi1~n\O!X݇N 5_ qf fA躎zMRR#H˵|Gc\w&j 8 dK6q(4i:6i1QSK+?^^ao>!-!1^޽74ۛC{Ws%2nC#R]*;{nArO@wZO{$9L:sB\Z: -(~@=s{l4=3HR2:W>e~&tX߶2Gr6Z対1V=7h6ET tsbr6ShxlGa R!/!(#_[<L!G;0Dq)6sp ,gW?Uzq;~:gkK"=J¬((lFʽei4#[8L4" _}è#;WR%<(@<ԎNQw9)~g[&{\%R@H^;Oe8vkc&bY=f;ϫ2Ȳ*P5W{{@F9GWʾQjCB4o#wi:ZҕnRҰm+Q ܺuXD+8q;T}WqDtK,fs?&85Pղh[ӂC|q(*jh~x;?:ےTC ;/=3qײjuhGǞU { ?+tauQw}'؋B̐3_z1]?մkd.l`1\/vodƠ7z\?)$?d-<"bnnJg/p=&p$R ٸe2,Y-<XL0[`Ulk< j)pbv]1Ku8bL, ;b?7?_3b]6)hV(-f͊6*ثb͒ &2ت[)|)nzBɩ3?h{Ha4=>YV` >y^t5p 9[d#=X4p#?1_$$lWcy5^iӥHǚL%$DaS׮@@#Iv#4aG\ /wɝSYSЁJi-Yؤd`hAZ%0c-Mj`@WRfĩV`va&`ma,Qvp*ONTFЃSӶNEZRzWzJDb&[<\:}m? +Vlyez+OR6)<+mLw2LޝHhD(j1i5Zۯlca% e"w1H5K-HX&opźP1!mԊ݋x\$$*)ՙ@d2j[%`wSl0ӽ8819/D^.w`>&;DhI o䄁 l¤ZJO]2 r%DqG_cv&ڿ<#}tvfaCd ĚF~ k`#dC~L)k7uڛ8q(`T(>$nBv'G5%zIۗnQvߏL9k^EҴZ`hmxջ-dw"@y"yznqgwp(&Ͷ(O5P%cYG1=Ksic '/)Xj>o<|[xUR%PH*W VdZusѯwxl)٨F~BbTӶ%wdZ+=o@6>Xn<˨>UtݠūX*w3C_&RZ ?Z&o]=Qou?S;x 6PgBF&GLB"Dty|Iw0J44QoL"O\!+CYD ʞqYy's?j?%_ [:=yϟZ\n'S|Ck}Ϡa; {nTϯ&S\cT=3L^92ÐL/5~ra)xU)&Us6ӱ>8t߾,jv# JVE1쒛kߪCd`NԦj_G<x<]$7݁c~ާbŤ'O/mGў8cJ4/2<=_5F es{pI(G=MG-PDqi٥o׶k@d́іجxZVAj*I6R'> J5PSDsO?+QmkӧEbyo=$Ob2qF[M=:9Eצ̃qA*|2}VYBv9D ˵:T|k{ lj>ЯLuekPzW| g%-|, / Mi 8MALՎtЂ(Gц픠bk"0daPFjZC%ch)^[LA%AÝ'L"d[<泪=~ hvCO&6`Kz2.7 @{>7H=]K( I*)^ہ. ND9(@db(2$IίSazO>`Lۋe#QjS=LM3q#0L/#zfLMb5U1;x|g~j'A_7L~7ɔ7~ W ~ej[PzAz, /%F_Rq]8ru{<@}ɣ_zay soo +`3b8y]-Q>`lR),jyQK-pHma$?}jz~ƙ Ǹ/o1<}ߗ$bdq(Jy*5V@h!cB3Yw}7֠{|~iWߜ1* *QI6(0!cɑwFCrI5 r" Ϫ J\Ȭy ֚޹+jyl$7F2DkRCFq?K?/F*IwJ =B#l;;%0oY{ QrO<9~bO/~^ʂ˪\^$T OS8,S^JWnO!,楉s @tGXAI*#(*"U;S mjHʲJiC<ҕ]!#Ձ5w/+>c?i15\u\9 I> וIB󖣣m I7΄/ߞi4KSI# ׵3,"q01ڹs|? C&9G(i־oE蛫qflz? pڽ|_17><Ef_[h'\ףsz"Q^N\"la3qLA?;iZ/,qvUO 6bf0[-l>r_lٸ֛H;(SCcSގ|) Ppw;Y$؞8m,p=_7o`\1cC䇸@~_9.W^3Ť 3UЩHdvYxPD>n5V!IUvT@gzbAn$vbEіB=艴, =H55$!BQy}zJ$a+ lRP{|GY$j_v825ןWnK')ڶ+m׫9ir64ӊ`b+[ K_ y3sʬAuǽOlZq]]BP}c/J;uD#b>eZژmk $>p cI>q2ۿM TnIzaݬ猑m2 K8G_`oq'o|Xqm9=(ۘߦ -pڌ{w=2,F15O27;dS%fXq Уmc`@jm!꜀#>i1>L|ln/S"i|ApG-n]B쐢Cw>՜iam;A?FGiSORr GQ_ZMa Z= 7K'<WPog6孤^gʿRV] v1AY:|Z%l5GQ|/Iwh:f?OWH}r}WNsjVB <rO_`7` gz5GqCR߮@hvVs1[Xd"FrL,y=e ,=RV X|[ hчH">a9#.DH2R6Ҥ^C4 qEj]׿ڵծt?Ug"5<2vy xol` <%|5yC>69eDFf <.cd"1fXbe,`d..͊W.$Up# J|,-S7?_3b]]ZNlUnV;6(vlUٱWf]vlU|10I1- (|t7W?/;cƇCp7^t5^3qpg6})t)a\ Go j?FX(kt4cI]Oact:e|NŃoA"CJ7qPřv ]R9W-ٟ`Y:QvUV9ߧ]DuP7*\ص3]IkxI;{fFGU! Q2' t."yhgF FBWkcg=R`?zﲽ90=}P]{jMԼ,Q$\N X(M>517}= ߳GGc v6v^gt?ֶ0F r)}//'~g-P;2]p L|״481d_Z ;YԵg_Z-LACo@:j-B HQd2闽c-.i*GUL%KVV~_#ޞ9FFAR!QLaB+MN[8%h7.-@O5Gjd۳7EE&h&gG%~ ƽ2\stwPƆF{Ϥb6'd :3߸:e*c3 nс" RFo"b́#y5 Q 39Ϗ}bx`PR@ SAს t Jmӽ;cT" *2-snI<9tɘrltN6QOzawg6Pꟻʌ8qu ;;gAǦA>2NɭƵÑ@¦6kB:S qqG~+zT{~^fB-h؃Od#f*4V04>Q%+ZV rmLlP[~*'Öm^6T+~\ "!FȻʚ'MLoČ5we?dB#5tp_)=_#<{v)įl nX?`0jw$"W*1?>y1yҤ\Uf;{ߟ/ y/zo*y{o)z@ẇuEO#ƻtTc mg G&5yo̟ԼWYqshy|}Qsһ{?3_,_͡j5&7j$}:yzo +ti( j/_$|y=P\ݫ߼43/m^0\0&W>s?=NGIG2T~/;Gt-D| _sN_NiƤdzl:9^mlA9gȭO\Kڟayk=Ϟngݍ}} h}}^͜ 齲3p}f6#Zc0cEOLVݙVnp\M1B+J}l[Zߗщ}ʛL:١9{Fk2UJ! F{ Dۻ|'ad& kVBޢ>乢GAUT+[q#%~}AilA8?޻v5,&}e9׊k m 6< !enIg%9/SZo_qJBg266? b_Eê[aدxte5!gXu;I֣0A ~μ˧Mk?+2O*Ji"jIZDG_9괲VeqW|:36LIGCeHi_$wF9Lx MHܛI~~9` YAEr+_ƪ>D4muD؀`ƣ1\bAQ(ۦW-檇4*)PE(k9ᅫ {^LmQ C%eTISEkCWZ7lf GMTĥW|%p#J"m_1)w'a.]-|rwNd#I$ ƿg!+v, h (F  X9W0! #,wɮxl%7a%vgK0qE3#(BO\l ڕYX{]&rq܀ 6U 74<vi5ɗmpoU8{mjR@EplFvږFi0T)f8R Mgc_=I0Տ*lNFGc#LJݰ|d^%kdݞ^ٍFGiEA$"eLy;K?RfU^m9TH"['I>$bFH$I09 wB)>Co?>m@曨k"9 QQBj7>fXG ژ3#v4(>5e좕c~ȤY*IN[_zŷ/ݸJL:+f?f~DFA$y?Q>gAowjqhױs%ߤy,R$ڬ'4 ᾡSƏ sC{>.{jz ;aηmgDV6_1usG4{ł8@cI+o"͔gfvĞ|)3o||qUӶ !Maw&.iI+=3-E[CjP;i 'q=G$,fu"?X8{~ly/W?ΙkH#iiE>,4Zrޮ;g+>^gn\6D>Q|߮dVyF!pA{plm}v&|D;cde PԁN^hD&;r">8/  }_Q֋yDYh(?@|HszϨ=>ƴ}'~{185֦x{ߛxLi~` $wvb<]1tx|Z uCMQu(i  zsmnGQyvޞ1>nV ="VM=}>T(bzuHђP7潺G n9tD7Q3n%,N@C cA+%VYAQ܆9)77ZZ/ڃ*+|c!8y1_5^ ;\͐<r;dg\G^應 Z0y1(y&*^K%#"Ʀ_ )ࢦ8U=d4a;Lס!s*S2QElVP.0uLjU"$y7솕 =jFL[3n4"8W9%zk+GeIPQ>dHwU nY;]mQ+y3̋MTC'WolI}W?8wXIWM S]N"q˄ݎkHv QCW)/\rq H)v uGRH`۱O#>i o#jig}43@1&/11K; @J?k;y/|Sjji@=2.sLX.hx[Œ)&?@Z, > g&HuG/"1Ěʛ ːDҼ.n}m(8 }w~W֌ dB*c/ώ>L؉ >,bqYW#g1B -tTFr>|}!gPߖ~VF%6l2 7Bwyj>Ro!>TlQHl5O4icOW^zRn?̟vz|2 `8¹AO d*Qd1jd @D˦,0$;//6)vj[nu6m)\Snq'8i*Hr@0%z ]]ӶL xRثb͊9YXvlRءٱWf]vlUɅ(9zZ/LPfD(yrP:ɩ3?h{Hc5 /|hO{ ˆޝtQԍ>s"-U#턲L1%3\LrA*e2:aۛ(v8 S/~;(hqǩv G&@<݋v錃lۻsA;v-*ۨȄӰXxA1)ND~sa5o>ޣͫO>g?Zקߝ &!o`;[;'0l80Fy}#{/<8w> 4>c6H4IoxEzxgN<>w̖uX:r z>Z7aS}?:"1Ad2Vs4_/ws>\ h[6aٞ[Y؞aUj ?.9A%;Ok&tBP23q!}xNe[p?@J #4 Ht*#'c@cuee#kۮkz<\"QbCC%cv^MTc[w\P["ьV"[g-|Or4A 2ܚZsY#r ]>#3w$DZWn6ӼjpMQH?F[e"kU㏏[Ӥ*@> |Ol-4DzNƇLvgyy޽ywmf3^lk[)Q B:u⌁2l_,)6D.t-Y~sfCgLO֭@b ֞ Dwj3r$۟c.:TQ^ ߧE ekCƠBd\EE= '`pNMHRԏIIʭzvK$E@)^oBofihC(?^=rکI= 7 VHsI b܃tȅh66¨++~A{>CTz߰=v9ms%v~dO2<\F?lJqR;۩.-?5=Ƞՠҍ.1V? pcbFk[xWe4*{g7:xN_ K}y&ت}*M/p0v*bKyoX 'PXm<{ňUki 09Yw?7V0 hUwXl 29g _妕WƝTs 1 .+~c:>~}WR^fQUl*p/j a $HAjE2$Ջp޿oZݳEk?1~yu~`V)~rFn.I6na'{YL 9m|ՠ>_C=g?K5Ġ} kOY5e'jANp=4@?zNW[t'ng#5>y.tg^K|<&p{X?s熸JO^}W>>C4_!XٴiݰRdD6S.n7!:SغcӮ )VƏֵXWbYARI8 3{[f&Oac7]ƫ?S3ml}2T0+)${HIȤGY|jEYy믇<ߕݫywojKu,n٤h֕M1.#VSs_^%":Ҏ/Z腕ۏ.Mx&>[+%$P83(4#'1|9MwA䟙:ހmu=;I8dm#٘p5$5O.]Vћ぀xO,Mv;f8$G@ij!{>~W~rhZi) fFF @" SǾ]8lۤݗ{O0މmET#j}3žQHBFT=6贐]ZR?p&h E;F-d4u*:K-mzw1#/J2OJlj:`0 ֵ{I *xF63 FVqYj15,z׶; @F@ƚ ED;"C1ItG+Ilد^,64;S2`hN4}VUNJwn D[$m6S4U@pD" b!%4W 2ky6WS4{3swokIcA߫z||rw^omet2P {Y=ϡ^Uڜ$ ޢՕَ€3q`W+p>wH7hj6bX KhԒX %M&+KPݲ2ݏAN{Y}Uo;u:+OrbխOD5h7=y}fPZNv7mO 刾e>/KU`V/rA̚Ϝ70Rx7`XWms=xؗnVۧl~Oy7Xe]k0' ο9|>^t[4J/FG%mZȾS?/iq lGcsAs&A::&g姓:JMMwVM}Ĩ೪E`Яt>6?>!O!'ٺ4ewi>Ե\EqT`< ="z[/qMĦF*zaݏK+T Hyq%>;yAXǪ64# 9b}.w=JR{[N??0{[N91;o!ZeҔqpP7]_e:jA| yL֘spKQH=?/'IYr3H3<|t IK EjfMne㞙3C[[y^AU@Q-z %yFc{uI>C~}I,YJ$=h{#FLnK3Zf$ Ttlga>m'z@zAF=/b{Tm#0I>ȯǽrd3B։kb6N;lldؔw?Cw""q*^ +L/0T`Te,BȐWrZێ 'ƭƞKS%VmpwQg#!J w1\O NMqPcr 74= ;VrH( 2ZPeAV4΁28X%6Lw`ؖ>&'yZ" NTlh6 4^ywҪ>}ҟ=M )_~$i2Kk}xr;}/N̥n # P/>SP9 GՂ#}3\-qy} Έx,,}?^,69~TZ[p^EV[Bv :$S8%tb ww=|:e6H ~f~]Nն7_Em{vaÜ^yQ29yg<ǨOs< ]OR{!ҴiىOm§:)a]M?Qj]hkEO$=!7`dw BW/G6.p0z|X͛VO}ߣUi]UNyFLLX&R#xmi!1`#ƷβD2TЂ6#sdsh6kUc~Wjs^ՙ'U:6|sSXet^ xkS6dCʀ>S^Z-hmHu}5ڈpLۏ4}_*|ɬyFmw,K^2=м-ckr)>=PZLSq[M˽4ܷ+75MO~?4+.C]밮vј#&Ye:ֹm2Bԑ4,}1XK4倘1=vK5 x{[Q*„y/mCF$eOӞCn-6]O'˹о\Ηo%OxaL9 e%W~O'VxR=%ADy/3M#^]{j37+Eb~3^z/"bta9 jc(-L5:N8|oզy-{ ee;27tq، 2oS;FQ%1QJ-+"U6́]]]6nXyݗ\ime᥷LI `B>cJ_2b͊sb26(vlUٱWf]vl!]U b-  qATn@g&ο!,ށχXlF8=;L3ߍfA}>`kNّƹ;~G-T-q Gnc}L%I=i1_[&p%OыشM *v  Q{ 12'rjYiNZl|$UR|B=ٯcvlD,q ;L?fᣈP%?yְTO12,JNw|Z1ԩpU"ru8m (O7#pv]Ƈrooˊ9 eKYCbzw^`;Tӵf-"ʱΦEMO{`JѨI,Oa6[FÐ= E>4ݲ (US(vQڿ?|G'CΤS10"EC@JIa,~'tVv1Ÿ= *7r?==q>rc0_mdRg u# `Rˆhb:gLеtXG*ᓑ= v[m~kj4i^7 ׂd$9}[ G\u0zݬ4]bIʨ;Ё;T6ҵ3]3 걳 lr9"D/iz^Y#l`~VgURDo Wg\zu{KS[zTAGy0׮tUEҮ$KƟc̾p,f"Ȥ !ޕvΘiO`]bɦd~"|#2W[ vs@{fx6G_\>h(SQ) eq}^O2 9tٿ.l~?WMMn^R*&u9K 4)L} ,+An*M^zAL$,5k_y-CX=4IHwOkZ0Q:֑!SEJdW1Zwk1jE␗:y@^7hl^ycQ!"I)M>&Yy -q'~;ƃGqWwNR,@ $ e?O֛!l:;΃׼9\M.KSX3C<8ժ ڟ6nL-#IKfhdˇ0Nj˨>GVH$_~};E4AV|Ս֗;[hLOJ34lw}WQų8G#c_ 2y2Y7q(8q7cw3??B]JyI~RK΄<ájQft6䵐BxO3Ď\o/?7$yE]vs;Np[iuRr@_ %f*;q$:cco'>vaM9v:WWzdSH^?MW'4@;/o Sޯc{IK;[fi-w"n$oQQL&_wq<0e[CH-f 'Elb~6sh'fe*={wgFVwZuLɨRG=EŎR_vo%7,mb_,.f(j < L~3̏R)Qx'1Fd&F1YjuwayYѶe${#,"RC=_t6y߽}~ImCV`A^mGIA;w`>H#発Q=&o|OyZLܱ.4@~}OyV1ʖo6QO.2EFFJ`rtwQA|APu+%c?,;sRSᆛI(TۅdP`g8q?>.j*M2;,bFI/vh9h3m2Wӭ(mH.7Q@rĖxe83C(aͯ۠mX"m{MG <nŠy6դ°Ȅx OK,凌O%Qx}$ȩHO{\sl@u 5Q&j;!HqH{K(kLg[p6!PJZJ?1'gݎM a҆"_zln @`h@?du&yPw#GS`! =1Nx.Q ʿ:`:tck(dOc"^\t-/=[DC(@ co#Fve45v "PA.b*zmQCem Vr+g:厔u4z [('̍9,mX]HIZ޹/*:r5)KxDR#~hbX[L'&]AG?D1S B{'A庍yq1inqT+|CCgba=|^ѱQ# ~4BB!|(IV_̊+>`~̣NYݸ3[ǥ3d3ȊPz䷧$*sFD4qxz-%EGߧߞ\Xwdf~Ǧ$MOGQyߗ_f Z#O;#$~*nt-3H<8v<&'Wjo.2Om{vtxK7'z{ ^_52i}dJ^J},ϥ?厊[{'뜄~UcnM5GbȎ zcpڎ7fZǓ.!日Mn~̰0)ĭaҽK9:|p^L)GУHED6A86OHJSS#+>n@_uQnˬiU|؞~i-kcmcGНIW~cljjZcڡ%CwopϫI}`>{3(5Ye9<9㸏c t"CX6:v'\0rh(C>|'鋇nڏ ͌t\;S#MSȏMa΃j${{ u bQeNڴETI9OOg vM yo ~&7#Q8ceM =_֌Q=v V;l|)͒[_څ?!?2r}Ϙ@1O$<{}+Z>sqZ!'mj3@ƢoζgqbRS:MеXo!x%XCE WR&q v!ߑR(x &*_}}5qw j1ŦM{.U4@-L?џO'}?}}'~mLeOS>Dewؖf]I?rY ?WhZu٫ q vQ]y(4x5YIvSm[|RSuw^nƙ|_dQtLQnǩ#oבWarNøg7۾aOQïW]?ozϣ Lu~<>G?1rQa{S4 jj?E33*5.\2#ct1aC9lRΏMyvƠj6Q2#. -F[?̢ ~cQlZaG589J][E Oxݷb Q2LBXJ¹:cȯ^'m\$@M{ABpE@bpڹ&+񝩒qe+QvyK7쎸diO{wf4`KE!rO 3RE5yQ]{}>Cl`HS1+J[`wqWۓrjoRlρuVI)᷏$V:1/-LqXR  iUlO|F"_ǻ{j2y/u&k5BW+߱jm|0I /R Yxc#ӽ3tK!丼h:ЬnZ=]|+\;qmypĚ rٔߙQLpڢ;.fI"#_B||r6Otk#DZI\^|pO=d,]UzW؎,9G6evOFJ4;JlA":{d@tpD6b?οZ<ң]ʚoƸEqRsN=?#.~N:X@.~w Sˢm˄Em:R1\*rkY epHʜc M 8kf[`-(Mpal!zvj2,h2f!$̠RI&pTUy<,k~YFfO9cq =j7͏~G 7r{ˍ J.ns7xޔ uR;~5xyKɟvQt1ۏR8J(XW_$(q;>9.>g`\V|TS!C[GoUvLߓxLz" [yJl½<=e:8F؉u GcOy:yeYht}=-xז@ V4?4SCO/B̋3 Z7;_.H (Q!ډ.,cG Gs/fJ|9HׅNԅo2iZGar/- Gަ~ky ̿n XԷr?d?8,Ybk~;h;O6o,z;"s"Fh{58:/'b-l&pJ(+_ݸspѮuO(]i'Z^zd{=O&gX_17Z淌CL柍6-wlԵ= KGyMJ,jn;`?O[y4S|')>ӟ=} |zαIZw^§ 1|_B5#fjliF=0ѩC̈́A\g'o؍"In=CWݏ=A̐8^߶ɹ9"C3\Ac%']Z[æ!5\ݖ}%B6"˱mrv Kw;tv!{y6yϩ+Eo}^w~ [Y3!R]]z!zgMѴ-dàZ.ţy}ԦIʩshWPFgNp#waeC-+6|llw<&cdIv }94۱dJ|nΓMH twې" ntB9zG@2bG1=oKGԬ5Dw1'{{e|Ej:gleÿr:[iT:T90XG5 P_~{q 'Ol̜+5> Vjd~Dۡ.‚2JO|TMsOMKR{b}RyHNlEv_spw\PAv|&յ"-;9Bͻ !-ѕ7 (>ⲙ9f9 zX‹Z DAH;r-LVȔ0^[PS;7IkKHYT($* =vEwKy!|[E5kVrҴiŒ\W~*aI(X#{#O0>xc$#'oGDG]w%Z4[u7]Xܰ۴cg"[(Gr B3Gܦ[8? # m\Ks ؄(?j0q2 JVGK/dIa%ycy}t,=̊Ϳ#*)? c楏rYpD͔8u ۲w6(Ĺ=;k¤dtZQ]oփ.YF ?oVzOS򝮋^CV^g(d(ۑfồqNClIf4"I& S|̨F$!.2}ݵћdܚ<#q:?)kM8^1SR^ 3G喕ui4M)Bmo9Vm'gGB@<({}W/&xu_)=gCW$& uNQIj75-j>`m %8@_`v0i"dv^qwǓ5E43ڼd2JοF;~ndVT7z6Qܬ,7 ʽG|frqs$qqy#ʾX%oUAJ[;Ǒ?1-o[?^ hUnDi꯺ԞCؚC<M#9|^k;zˋ47Qw>\'9jZǝoR]Bp^;\"w[$S?dlIuϣO( FPT* .oe3"Ir#EXϦD =H_ yo>6 uu)d24ߪ aSƣgm5i"t™sɧ h.of Cz":y'WX/RmtY'Zī3(f)!"Oy?M4]$ &1ygł=cOřx r4;9ax/z>h0_ݖY/|Ğl~m(߈9S]_P!yZu;;{f;d7E뛻D[gwHxw99{s7ib8FU/ô32y_ZM>u5~7z(P =Λf&zWcvNIFxqi=!zeߐ4sun Q(H+nNzIUFI_N>ўབྷgcнoP)udw/uJ~C}} >z)>!U$@/M0qʤ~9˭v:ҢgiG9Qjwl6Nq,]TSd y?dK VQ$g#I ViNBDhke)2)1B cztP6568aŘq9Fny8DF@DKWO_mkv,k2yJ{-fJ܀hNČoӭ.0qi„~'=pnNIbCo=/ʯ6Zu-;ZƿܪϦ]\d]Aևp__7  ('b oז&FE靆 /I侴k1A])᜶VQcQQ ґrh˧_M蟕] o%&v8I= ikĵ#Gm7̗(Ftw-J7qƋGr~ouX&]/4֑bF(}6*>t%>jWP\v.Cr?&gn[; ,G!EZ~E44X7'r i*@j푡$xlAe(H}X׾Yse = դ 9YAMqEQ/HۉbaͿǔZt=y o)C~mռ9I$(>y|k=X .o,!ɘ(pA58EZ)Jh "-s(dG, v12}C? ҿErH)FpE)DwQͅ{ #| v$^8Ëu]&E&MI S"7DK S$lV2=%UZ(jׅ)QKNP|)aILNd$aqK{nT vVnGfOז 5f=8UG (Od<3? O,;@uۀAO~/gq]}"P~JmV^QJxzWov+CY{MH~WDDdodG/?9y#^N_M-Ayd{#+iڤ! doՃ( ~@R [UvsMNČ)׵SNDii!@~?2/hp&q}[tؼѮ_2s66^v>շHX}CJHSÃE4wuSe'%nxYVFڭ=o:@yX)Ǖ8|鬺iHzwk>vӵ[=/IU eϬ\1]tЃFY/&p,ydrGO~WA{`-Tp0U?.1uz bK1z*hs yW$b u~cCH<|y%9б5W򵆠fOl- E9 ,#=-F]<^8xįC@C0JF4)k*PkO$dKSfh4Dv0̱ p831(1aK[ PF^ZNI:TF8-ywc!-{c o2qrO[j,>#|#Ϩ=~kZ/mq=@ҧ;\oMig"7J GfCvlaKONZ;u2L3.eP=2iv_R{ ;. |zYSrJPT;˲زvW.8 @.@" RO`(W}+a~þFN1CMm*\!Uq#5fD 2TB3A*C>*v'g}:\{ߕJmwٴSP(ڤINyW.X)7b+ UrYtݍ)Q2+uIPd `$Wzsʸi6$ҌM=73F$]O|N y7|o@_brRFo*diE{H>{nLoQY$E8wQ\#fq\H"l_@Wk]󗞶ɠ;:y8 5r_/(WCcֵ3GO/Iwf<=iz=Vo-p Ԥ)h͌2 bly7 Vϧmn/,IC$lYN6 #*{ Gx,"Ezq? $t+^cT^F[*KiTwI@qéL2ӻ4cL[ PBPҞFcy >7 D[ j=J3֫%y> 3jF Q>9\Zs{^:oq7|A]{㸞)Cϼė>dŻ洰 G/?Z5?޻¿.^fY%}X&~ Z]|)jtx<_u[;;'Y).V,ťkbj!ې߉V=(>E~ڊEAf8LGOK2jaK/=CڣmQBmOoJB?g'4-CA.mT {3GAǗ[7#uGM9C>;g/;↟n1)^6S$BhGF}]`9O0 8$~I77;YL3{~L$W)zMVadtg~JcImm$p>OljűPm[:GZ ?'ຼ>[61I^ ?dnT(wO(a{b% #<۽D 8:~JZ~ _Ώ _7]ZԗGkp:sh]Nud|GLj3; ?fTCnsK> WLx{? |3z換JPzZ?,l{')N]G"40T`b%߸e]zgCHtpbF4*};9Okaǀ/}%"0O$Rlj mH@Tȥy-~%Km.H {dSF?oeFWH&r70*v>WֈV+ڟ5!g}tC5qZ06gpGY {87]Zֿ(Pql"T`jር\Ao%tӬ4Ed)Z$z1bȤUz}#AڹAb5{bʳ!zqv[7JHL,@䐨Ezuiq4c0y+)f16Ëuo;+e9S?!4L2'd+,(ĭ~$OGxrHNִ }㕝j˷M17F+M\Λ㏾Wߦ1ӌ~$Z~AR̀6lF_3v ƹMÀijiQib5|W9$Zm!rқm噡aǩ fHXE)* 6Q2נudE% hH=?p zOtU #5HAp<1+֣7Z E%/cp9[քrR+ң݇n#+: 'GҘ w*{ r7ġQ}72ǤpwtgUvQ䶏hL&kӹ|څ. jr_Y1Upj˟)Hp%wf}ƮTHɝߋ7ݲ7cN9\?9Xcd'Y/o3[ X!c,jnI#hkexe[bP)~&ON̕"٭K7변&iEu.VDnmI4 Qkɿ6/|ۥkrp)'P1=E' M,7|yz fkfkr:㤑W>XK<^S'^I'ty]s8yغ'_E|Lz %˭`v[e3Nb{l)Ep;w ݃cnCx޿6Kcc;sgb31;Y~?o7ٿ?+]"PC)Imi?QăN2}9 .H[p'5 j#T Jܨ4dV<ޣg6%Tm؝/8c=Lٌn&F%j~%R?ϾW(_6>lFm2 w($@U~QݮaylYRFw#uǂ+eҘ{We݆Cmt՘|xqMwVӧӌʋW1%Gq˫=9F<"(-5Z4,]ff,ߚi[>@;2SF <l4x;re/r$j2;{agr'd8ݘ5ҀV?+o?N,/.=yԁ#D>G^~= l0K09o\g+B)27,Y$ɌG.l) ey"OܽP/Zu9~-?2:,41a͊^AZH>O.{$a;1:r4C ڃS0 ~Wپ4A;cnu\:in C2êjķe-F<¶ڌp 8+ГGRlO'-:k/nX*#mPRE)|B[L! 7F9b.}}&HpSG^]5 In ;|ܳ RilIS@pk,-#$w)*fŔWaҥ˚Ʃ"K#RI:SƤ0LYORd=ѫ0{yD_\7vߔكC[}2;JP}랠٠:ւc iN&yˋ-pt~?m65YĖks+,BII.I?B|{U+A;bM>;8;Đv[8R-79:RVa3pD}ӠE|BEPΣnd:HpWAT\{f:Oo2H>Ν*mS[T'qCN2X1/5{m'_.ZC.k2CAB$!ۏٯCQ<s/)d X0 kݶkc4`vt67ۦ!,Rӓcx|@Ǽ1q.õ۴:tdg|iq71^K:vKQN{eoޟs)Go͡n~XyuyK=`^2 )և -y +J{gf<"w'4 yOKygM6pTemO$՛eNj&"<&޲μ,#PcOǖm-M =޵ݥ;Bn#>D>˂]vpa9%q}y%z,D!Яۀ]7 O \ to0LGi2q5㴅qgo~#}y'UKD}?MVAiHG>h㴃5:#̏'3 X]- OR1phI11uQcA3#j ?IE",5,ՠY\#ZI<}jV10ym~Jw\fJ)"ŋ 7rO_m:dvYYM iUp>'awlUZgu0ɎU7qu-]iF`%QaweN/eL\q3dɔq& CZqkzי,ͼR[iz}b" skQ".rk{*ri?sۇ.)}q=m-,A/P3# bm< :1?KCq~7}Q /(_ˤz|lzofl8J{5-ߺ\7Mzr)ufaȋ5je坧tImkؕvXcJc$eWp+5\Tk|@{birEr$)w8cu+v8@^9RLxkwe@ 6ژ:%#on< ;:\ vKrr~" ½3ev|O =af$:}𿊧)Í>KГ2Zhum<%nV,F^@_|$qbՓ9>HE:0wZç4dK #';u(Q M.,BS5Ef&pܨE6 ;fDvjod(95W@zX̺eXlLΥ+Q:B"gxV&$m'|ߙ:Α*Gt,7Y&?G9SB2zf=LQ9--Ac.0+Gl_ǫ>KZto:;I9@~7mc/^khs{yJyKnvk^DMgR~S9]{9m;[c~'\uqc'wa*?'M֑Fe%sͼcA%%a ϒB3- ;[2DMYleckբ?-q. ª{sYo " xkw;G)}~{c{F19;lrw7po3U7Yi˫iy+st./Uu>,Iռٯ+A-5iTAt_7&ҝO#u=,ςz/+_Api Ԍ>~ǰC~~~i[~Gb#y +`kFۄSV/5SLf{wZ=44xīϬ"<\?>f|3LeT(zA,nLIbIf&IܒORO\/;ߤy˭n}o[mV fFn%Oޢ a//r>f?0!JL\[gҽ'V^l6[4XuG\]Wt?#᭖o_Z9˙:nt@[bӹE&[4z`f9T E &@$}t-W$2AFO6ϣߓ:(5I)9OIL%q c8%q>oO3."7:{GrG`ic'L>yo'(,IM#9YE(H闑)o.`bcl]k8.Fو8.b-cŕ;1d>(+0+l+glUٱVlUflUXPثbf]vlB6XOl!ceT$qA(9zbHJ&l_5&uw fzψR=gAP>y 2dJv>"+;2;~PQS;<5čG fU'NĔLзe>XM;[ٽ,q+3,ŎYeI<ݲ3"1O 7.ΏyJ"DE}? 靅. ?d &a5΋p(0P\->8!#0##7Y#r^I[^(7`IoB>6 %Yw$\iBVB)M @>9'\hRobŶp^ffWXvuLN\s&z);8AH타\v-CaF7L? ۮH!XJka漣© b A_f T2 YiSr;mfE_@JlV]0-В BB܅6#{lHܠ8 V4‰ ûH o|9ANHS"N1m#CqL1Yސntʤ,JU?>=FZS~˼YTR*=D@ jDVb(ǟ"I\1L"ּVI(HtJU]:HH/^+ӊU;W;ħ=CсCpG3Ï%t݌t R u/ߥzf56${́*E1DrVzS̋l4?c䕝q . + {2ר8e q}9_ G L-RwgE>jh ;N¹?w~ݧ-)|kƼ j}kxH䛻1Pau?%F5Y̺(c!(i=l LtU@5' o#pUPM3[-|Fc:[}d%N^؛ï5u/Z1]'PԠB S';"Zەs%{sM@✅UF7ޘF\=܏C4y^k:fڪM"U@)2I[2̋ե壴8kc*s9u'^^4fVf-/iǩ̘Bk7}]y]D׿25^] 3=Q[垽b G2{0)sP>/ǓO ?y^Ht)~Wynq\K~_eU{?"8 1Hm'&nWsBQ{ר9b1Fv}Msǃ>,|{n55O</HטΰdiGjDnx nbv}Ws}晷C sɄN'b:DÐ{HbѼ~\C,U5-oN..Chc_sj=q}  K ˬs%yPV(TJM7O~ܓ]ǴQ'>Ky^ i'߭ `!fe :&Zhv?ɍBg?$$%5^}4z2+z߽ҿev=:JUvv5× 8'̣<+GNAeq7Q$eԿ ;$+i9#?f 4VXG@EhXg!}pJGr󅥍מu=6Bn{_Sᶖ2*0 q趫hhFiaaQ >]Hd4<2HynӜqmKZ3_]1NpM;:44dc·1v5.v慴z㹈\[UЂ}Q'lIwͩ)_ e4xu49ϟ齫_7揘/̋?˨iږl|#La2'S:VlEU$ )4 ΋[o$- /L wԏ'ΗUY5/} ^BRR&x΍5}$1ft#SQ"ߨV9G&NB)ǾԼ橴W˾]wtXmW4d$mZtaJH~_;ӑ2HM1A#w}e.gȾbռzMZ|CSWo^}>6/{YhN%X9N @IJɋxe֧aNZ@N`waxJ⸁}u5kC*jl~XHcMbwYhJso٥ [lחZI=sFw0PHSP=~Pԭa2=qR7 \.`xR.{K-2+ܶݞEk {33K#5hs 1pǟ3=kf? yWKކk >6`IfcA=|hD(۩Q9[t+_/r$`ﷇg#Cmv$=@V$^@׽p r'd\riݰ"5@xTK/i c`t28a wE7 N&*ԓҞEдm4{* r(G3"-P8{?E/ ~V] B{li$)s}*䑞vf7Lh46qHR;\^eC qZ%tj,ɉ?#^$GY }_|DMppԀ>Q@w1;%_X{ϔQ`fIVrzjr/Ò,z=;U3i[ɥjk0V=v_io#c7i,v}om-[1ʍ<r7xϿZփmcLJ$+ZuxVˇ('^xo7SLho\-Z܆n)MĩO} z۾}0~dĀ>>}+خ{E(VB]y5Xm'-nV~g\Ӥ",&Tlib 4S1֠eo.,Y6#|^]Cz{y[;QַfIt%%sE*a}<03c'yvC=xޝy]Z5"xt%}}VAgq.'io!٘?1 h7igcߔ^YΓ>m6^p(ڥ'uBwO -R߻ i4\:L4x{G+iaE[\]}[H$޴#~KMٴ{[ cǛ?Inapþ?2_*~{yk%m5hN2R}&=sqs3x><EWٯh>~ IGL!EzgȭѥA̸lL)cL3O{$f8)'cIڧx`>,e@ cNیWc8v8K^NAv:5ij=$.ʥz6v,dmMݰQt :sjXz,=6A=ݜw:Xҙuގ9rʼnyMKE"tkKB'V\s )J-(!q`H5nx rv!lZR(2DԒzVi%|;`%T(QU$pNMˆM9oL1. K놰 N{;ʋ{5±Ne:Pl;aup;c8F0iN`PWzLX =բ\ 8|ܗ1D {f6NQjk"jĪ=s`K:̚3'wA Fh4GoOMBDV4#&i$b{a02gW}Y_[Q_ۄE;M}ʎ2$zpy3JgNƃî'/Lz@RS!`5hybRJ~v+;CE6*)-'h1ݨ5z_Y ~D1R#!C!YGe=;;DVi zԍ 1OLĀ1vf0z֬k !G~=YA˄rVE27noYsz!e{7R8zcӼ'38?#_FI7 ! ;A&MŪ7Iؠt{Nsuq11f>{{=ɏߤVU4["` ԭ?ސz&W{q؃k:yF)7\=Z ʽA]^x>f֠VO?axNac`݄U J"[bZ):u֖?/RZP<+"}E!޽sW[,r=%2.&~`!V͙unOޢ~ݬ< hGl;ڎa?|٪y?P\ܖwКm:0=#( #g's +ִK1Mk]Υ$U zcr_̸ @CA^dZL&~6D~9Hu ᩉ0uO?o4~LMsq%Uy-%zO{R|y*Xmtt-|dv#: FdRuѐo%tR=&ro/ik %޵ LSM0 nbR)- \EsOmwc:k^ _<;቏">ss[@IEg2,iBm(V6@_}=NsUm9g,|;Vs铆? .r5z+Iƕ n#bb?JL^ <Ñ˿/EgO9i_YFDZNsʿ/r]/p՞b<J vk3b<>\+Ǖ|Ӫj~P@ØwoG^ʞi_N`ft=c^>,zq3i:=/=Dבcw^tH\3HI cHoQ?'J$+OfUy+jzW)B$Cѐ*sìǫ?a>hǨoltp@;//6.ě%_$\bb7_3b͊sb3aCb];6*ثaU6*+BnjJ8񖄠銌Ȃt5Y?/;cƇIebA#=d#oM;g<kM20wgV]#t(M}2-%l-dޕ$$m3\+OE{dxAwvN |Ms/duD=}}ͯ7W:E =4v?`i,V(G?Ofv.c~<èYE#n#|ވu.cܷ8%=;u =fi>Ѡ'aX ~y0SҬ03d> #7H5L; kPw+J'ڻPƝ"$݆zT,lkG=j<3A8O;<8t~n tŅ۾xMQuS05?(=XO%(u(dA81^ޞ c.n&= g):^C_Sah;&Q)_?84{&_'+oQp:)_Y/jmCR_Nx!LsG.NBR>gk5Qm/,<~nl}K"Z.]hɜ'fT35}ē9'_5]/ʚ, q`սϥn>هju48Dr?l19gϟ/35y %?P5?7?F;NtQQnC OWh'}SM֭krZ%nu`cJӁJͶp -áJ_@Z|ݥF濤K N$9r7<4ߍF-txI4=@oi}9r4L/Zw +vCcW>||郐O#-:yxW/t>VЅ-oOH<wyb[EkB V5<wAig˥ q)_/9'e ڷ/fJidFcƛc/웋̶?S@{zS!xF`:rlSԞ,Q9"EAty4Ng0VZB=&p^yvU[L71T(A-=|2'_xxk%wt} qtλq gK1}+*Wa|[.J[h,gH(~OfS*Ὲwc2Q>t6a +VѕK5RAh A,[K|&DDu,L.74K-Ɠ1fx*E>;s,Q:ƹ\Sv.n@ ̟f2f@ȷy.ش: cD((@F]մQ?!ߦ-CҒ]KToSVWэ5 ɭI7#PiQ2%ʿosgFq1|x=_ctpt( Sl@@18ҋ#P~c1C 6c=~c1J2#Z=_C~TyM:VJf 5JѾ!NI?h1iYxc#čd?xe^^ >&o){wx L{2Hv7ϲ?`Z/OA/PTӧl$=3K; Oyf6aYiLWċS#"ևFM&6d'bu>X o\ܿvW>m>*dGY#Y ~k3@q{&##=Oך*Tv!n:}4K"0:ۨ/{Kȿ/$4zEs_fګ:gf_G\:f|Ǔu-aCi¹)maj]ȢOfrÄgpHv>߽dӉˇQ(:zy1wc 5xZGw;-ym/*q^Jh%Jc=_iB Jq"Tej1[yq!ypɧL&F$wɚ?WT̨>G.-:08<GR73McK),-V7[$'0GŤZM*žN@H9"lJ̢ARppgz~&q!2ѝ# IJ2Fۏ \ U@ۃ߮D-aI2 +Tlc_PviŮ"Pbqa.lqDKе;Myj4O Ğ+pshĺ|PXG>):P)[1 0~K")_֞%-RLFJ94sIh(Q%O5ΫkcI"^]' xf(ԗIQ\f'HVH,ݝ!%#C!Z |#%(3ԟQ'/מB.rIEOljԺUe盹bSk +A+NKg@ll֤Tܑ[d ~rN-*$(ԑ#//J9ƤJ֛csi9-}~IBa Nn8A5=[Cy;,A 9FPC20KXQ9UTSkf_1#CkNn! ޴?A]:M>T$q5*;3wCW #4K A5t/?1?/:iƷй9һdSҚBu;7 ezxf;O( !]lvDܠw?ѷS~j[V q>k'k8."pOn籭x` ?VOGGOô;.|7ÅyiQ=={M%wQ N@:v ١q 45ڽ&O (ZG0vʥ_. 4Rs "IktX?:P+ 0" =}z&t$ySm讼0xh>E:K{m>ɼ??FCxe' :t]D_Ϊ#?K dG/ú%fgJZl snMcþ@O4S)EqOpsڨoYg̏ .gLED.;+ASр? :VLF/gͳEƿHhHp~9< m {"jHjp]E)WS\~JIy%ъ~Biևg;3mV91 !_:g%q$*ެ$̽~7~ڼ3Oc"g_}8g^}ܐw̨[>Q&. :`Z)3Z{`f2%Cp]#lU݌]"T,v=}%>X+ӲAQC@4SnJuȐn˨۠?  BE(OAv@z%$%]%r6>9igDI0;q ٿI \ZH.my i_p? ~cU m; ڔ.zҿ RC"OTхv3*hr望za8]a )aƻ PIv2\^ L:Ld}xL6L-RZ!&u%pwe[.'\8g_* Z%氨;tʀ+fPz.2N|}?Q k M3-u$t9`〪CcZzCܐ)6IIiM; +󔢉Z˿*^.B?I˝n惮tq8&+H;+1.~yegH օFî,[c@wl0CE{mij /+D-|!FE 7iK?ʌlbXDy!`쨩??|?W1t1Ng?d.:@=e;cwh?|毟]D>a^GS߾zpYOdrYI5$}Ј{nPIl $Ev˸]์] <1uz,zyb$0Zi&ޔz[)]~+׌ʡGPF7EmHy/+~aS6ӵO:#xo>K@ 9C5;Si.xǬOGyʷ>XD5h &ShӨe>cDmp_g٧5"V{v[@y,.x.lӠ[]Ee=oDԼyvjVX&^,{09ǖ9"%až3Nmu{X=*h-'@KGSЂ6#+rbInnw/HHmMn\]:A6-s%( A6M/#3TAr3ez9cAy_u7ߓZkqLԡL5Y ]8w j:ƳJ]#ugsRϦUFl)Ȓ;[hpDhUEazzW|Mk9F2<"[em XũϦݯ(.#x_u*Gsǔ4)/m)/Z,?Z@r)1XOoqۖw|Cg@]HjHԥz(ޟ/lߜ^>e~ghCO-`o=>Ѕy;?g_G~/ ^7SMԷԄ@L_`}>WּqpW.mmrBʑG}ښ8G_y}7YǥM?X^ytAU2LhC-5K9 s a;F<:}l (7~IʉF&C'o1/6{y\˩iVED)Ni(ʎb]CΙT͡xS._nϘǫ *O} ]iN6q}1SKOKkpQqҞڳ 27ýtr;^y8l޺J,~_Iߨp[) ۩ ˟#'l"2)*#~A=8t"ߵ~;17ywN_9eNVfQyUG oǸ)iۉfs:*-*xgɭxy!Ac`۬c;]ړeԼۥygzBi`-RpUCQJz,RnA)䦓4+RK!b6`Y8 UdYyxٱWf.͊/1dI끟$a7_3b͊'lUnlUٱWeaCbf]vl*U,|pɄOex8t,G1!{+tIC)Pv2v ȵ ] n~J m j #5<ُ`Br_ᢩ @ayyK? a%jGp}Ccaî;>w\zMg8%k#V=Ş>/OQ*u>ҿ,鬅֊I,ƛpAiq'=YdxkzzD}[:mK$LxM@*ڞsbUvnb{҄W11cdªGgT@+2@pnROj3N R=>N eD}^oBeDCJSV 8*ho|k#)ZF3'z#2 [4~{S KՉe4:DXN=CAQc⋄|FB[ra#Aq<%ڸR$lQJyr% :x`i^O"ـO|pŔ?4q V\$p\+ c( QQ5 #}h}:SxK,Gģ7]?B%5?1IQOFaP8B#u(YN۳ܜS8PQ^3ё5uVK Xe۲+r=NulT T!qUN4z.9.wGhC'kp6w'm5~_w=ǘfb1(͔ITs4;2'M j GVjaoj|?i1?Opfw>Pѥfh50Ұnk|4#LH Y ОC~WDC.Bu1O(#Qϙ)5=R{[GrjHm!Hi@mZW6Y 1F`\bsðV?<ϩ5д'2=C𤾘blNO7kLmyP/=hoB Dvp?o![ߩYnYz *4w1|~"ES@O-˨~-޷p"UG:gJ+qt'CNX"ҤoSV28H5׮0ۂ۞L PO*Aaյm/޳ܬ;~(=>?R29FN/lhċj5[%E?DYd }BBqsn;iXw=Fy%Lvw?wų(8xHH g:V_hKo4iI5s) (G! وOJ*5v;?%ŏ BK}h^,@{9G]^WS߯>wp}earri zV‚:ֹ@f6arF$uZy `VZW$ @8۾H쾸vƐvo7J ^ CU*)H]\h>L7ђpq ?fQ9bn#^GZ`s⾙$+g'ڰ~=_km+Ҽ!BsDlZdn`opbQNݾhx^9TMht sg)g)R +%Z*Vf63F @d歓]P#-pQ(KFGq޹oJ;=bX)"⍋|HIC|? sԙ7$#[zI.儒 J&~ƽUsj>YPSbQ x~o&Kᵺ&HpN|-i)@W~!sw:\G)m{ケnwԿ[[Xq$1Gua(~@QUuW߹5 xqPn<ݗmJQ!';q?)ov=%hc?j7ϙt 4 h=A|9ƜlhmM, ORwVE>#8^'#pFWV_E_BG M3km>NG㿍p ڃ&@E+W~P6n0(EVݺ&'iA+ц!"SR:d [|lsENc"W(4KJ^ 4ϘwM$b}4eҪa^Ⱦn>l`Sw^dM# -$2K=oIC|A3RS=)!(00S^"@]7r Azt> Za oQE;""s0cJkNۆ:bBIc704 L;fnq!eQ٬-B$Z`é:W Z Mwdjc|̯.yZҩ"sM,1{.յ]9$ &0h/*::.1;QI|IldKKu!*H n52CPA5}#04?Q&f"؇)~kyC]"CqKgv9&75AOpDrv~A;{@f; ~Z k^$j:4w6SC-Wa%QԩE̪|=MW(风c ;ԜЪ<@Ĉo_!Yy'ZQ,{a' dy}o:mnfZyy׿>C͚rluŜԎ"9w`&5B+fR6|rzTuQlGP\}vgy ߞm0tHFIMo'u?F6iqiWqY M<89 1;O@r3jG ,w1kʾqѮu/Ky-ˋwwR]zm\0Ԑj}>+ښ6V>% V0fd?0l{om{,P=k_ҙ?'I+E1 j@an.m5kea]%Jbyc8^KVM1,Y.o{z?FҖScn=La{?NG$cBYmE4`M@g?3Mu} EFp@O,^}k\ˋlaDI=l6 4ɲ(܈=:aZNE|}!!إj{ch6vUkR]j i`We^tU٩Sfi!ѝ"såI58ZX_T) ojl0B+ leHkkIʱZ:;sZS'釛9rNma >l65z1شL81i)Hȧ\^}8T5efm;PSiIvWI&Y@M 5DdS~'t!#z!f2%Pm0Kbũ?W#2x)@~Fҋ36~wA#V[~ρ›.%5alOfHR,QI: PA"V+Va&v( DWi)ܹt^P,2H<3bΝ{[D^EU݉nS"ɂ#@W35ԞW<5%v$|uv('y}S~͍f Ceו:vP˷,ԪLP3ؼߠ{p|g*;!ޫZ$930iסȫPx"Cvu{?7ipʟK$@A`{f8d6/+4_7 >@bIjwXX$$?5?'ʫmSuk[NN̝.9;Hsp%5!EF|o$S<7XܩAd=U[CːӲ%u;dqz5q!H`tnL]ǟb׾Ewk4 ZR~F ,ߣ}f1Mn=ϋFF}!)%~GױWO3A5\^9ٽӮcz甿+smX#z7zv,p ~F=^чh]b1fL}?kz_.`8,>Rtz+m^jMm3^klkJMPk%,di++UdRCx1{W$u9Lr#{k憧G)F65u?ߖ:,Key/cM=[cFJj `^_vk#&lpq_cZi%qy?i䦓]7VGLQI#siW'Pd4l;U3Gf5:zxFg~\kן<2?l/gꗒ)g-CTWlTB#RlLF-H&]=-/fəGs5|cK 5{迸HÝ]urD_iL=)O 6ANzbzYh?3թ7S5R|*qfzV  `Dgbb;\)>2rvnCӀë@c.fB9j[əؙ!\!;0Zn:xabէJSNPu&.%H;06v]RzW egއ@`6bN;(IGL(.Bwp1v1QO# å$9 $ӗOxIr10JL``*-QԮdDzeЗzw-zwSޣ\weit؍A+A?v$Пc1V[رkOѡ-t@}= 2H&J;ڜ ҃4?^QTOqb<0mi R QjUǏfi Ƥ!\[`k NpN 1VwoMz#pucO?ʋ^R޽#3fNۯO|'NHC~_ݶX{A4q&V.J1y[zQɨIc%ý~@It%S؞Y4^Lca=M}p7k˧m_V1r:Aھ $d _bzcnHVœ@G:ޘ .eFU'1n]A߯l24[H#dxVunu^buUs(g@ժT~u ]\NLݧJep)#ke*_ec,cw$w To?-0Tc rj+ڟ 4`cmQ/ϵU(Eh 6;+1&%ycBaU4 UˋwZ*CڝGjɽ3:Yk4Z%+l%}霏T RDm]GE:kcX%j`+{הj\\wO"ZLA7|'0:fLsrcoKdNO;v_.91+PxE A[^'{Y]3E،I%G^ELJ4Lt?>I]Kje6RFE̹6W5?uH-; l(PI'6)OSsSڍ>-6 x#cny|?;ȿB^KsNgvd8CE=0ؽezf.A{8 B͆Y ڈbѿ+&$p?QHϜt9~covs,u\A+`n1)eNG T=bǟY1΢,^^cS=62Lj#p+]t/9~kvx eeYcꢟ#cs8:-x2t$AʎIL#̐L+2؆i^8ө[D+M`׃r Kxl6 jwnż7$[MҾoa' `I Ł$spغKO8gbbT u&ܘa3혐Av|}?ӣ]).4ֈ1rEhb!_گ6,xWFhy~?S sVkK[[PR9~цE&SA{>7|][Hs?cdŃ˟5М_(* *$Ao#\kMU'GVW&a 3M?͑n$tቔ.~g~uCU9IJhأx\l4kO S+Szsh5szfHp y,rHW>tmA.[D/DC{* 5Çï fK@Ÿ?τ|1 9FőoT:FoXzѫ}z?/-D1{q%#LqlyT}M,oւoNi{@v_ w UF;÷2OsK g'ɘ Az混俱~#{?_VLE*ۀp~u\&)#G!cy!p!. |`~-2,LUБGU=r7̐O'ğ7& y<5sÜ̝&^bt>[ #6o+]>( D9ŏihΛ!i'ԧC;=hG3zz^GZ;bt-h0j>cIkhǻEN9m~yhuw/0^߱tXWI`^]mq/5l5{ԡu&+Q.F$!>uǒt.֌^`u+U ֝n@H1w֝av!Ldv1O iΒy3OI]PIVxv"K@:imNM(opo|&z~—pTS>6 ,| (vj:v=|Q[@(|r,٩یN̝;v:i~xr@*k.PPl5NΏ^yJxܡFj{nUS:֝i}Ł~jLL ƈUH[=EOeFaT/Vu`6N߾yK 3Iw_PW >ϳ55HBCz{UyZo|[[Xn?ޛ a$,dAUB0Ny?˰yPl;OOL콦ifOu|_Si&|}GN-ܷ2 PSў("wD29)&ni11;V߼A#,ذ (M<C褋7&BpGP>gD-LLJ\|0B28g^W@i0T^]zec jF@zerbA*]E ܞ,d"]VؒCd`5>*bߡʢi¸kmjmıC=O<戠v-OO|͌kmp+*/Bz~&?*<$uVHCuݲbKIi<Ҕ#uTv%+;2R Nb[Dt.j%Ѱ7E29drj.adL; FЏ(]ђ M]wYn0@:>: Ds5}C؝3 XǼ7~kԵ fx|`9ej?s~||۩0F p'VT>pc~ṅf`r|_(j9Nݏ#iR<(seI=r'lS":~|%GjvXXbGW~YYtcEn.8eScZq|9G}2T}vebFsz / qY6Zqn[!agG/iwW?/TWW{%;[Rʽ@3k?fNaf/'λKhGCzyQ:GHt3د[j M g<ai~e~C\Iqjzco}`{OCb%ENq ȇyg&?$~h[Ǧk\!?R{wn|cFynPΛj{0MA5ȞLa< 㛜x(1⏙-:ԞFdDQAŐPΪ>yٗP HBk3)*+Lثyy5F)v8o,v;iٱKWbO cH$UqbCJg7_3b͊]vV;6(vlRثbxUXiU N8dP2ء /LQs"*M<9\8Rg_w~|[4z0!w5{ HB'NvK|w䱥}8IzaSh=}OV>zbA z@/4#瞳bǃ DG?{=4DGY-l.-+ G}c@9"%Eo}yk gikm 1@`Co4amA6-ٺ us#Z`Xv ,\v5 7S,e L~=]>T;2q (`*,˽sUC,oG{'&`GOynAAO SPCx~*LU1 ;DKDw[YwӖ@Qj6%ōƿ~Z5LiW(j(ɇȹ:|<Ѧ8l8J?i@!oO O@+oU ,98-7}fv5w*M/T+C_mB&r BGCu M{zm񳼧)Dp;҃#" 9=F]N[>a|=^bPY*9);RlzmvJI ˿AsxyVGUjzF'4 y+ =1LO(}*[4ٚ(i-z%yŽO_m 67UkԱc(OMZ[r2]iC]='\J`aoㄖ"4Tvle4 ]J=Eΰ%@, =\:qYQrr̈PS 04lXeQ% ?%ܘ0}sU #jWv$b%h;vj{{vɮNf(o/Ҵe>BzڬgוjaQJl$m8MRiI FZ|AfRK=;Xfz߶U2Osrq&]˪:}.yGr䁰Qm@mi) [G[fV<p5Yo!ʶ=I" 5ZiǫwOr-zzZ(o(P1ݟ1ԃ$^'-R?߅?x4\|Iłǚdp]d(.̒;;wEmC~SO;HW_ 8ˊ1<\l9fCoj#UuB!&BWԡ*6==~eY^cM[F`ah;)v OˤJu:nq1:h~_yw_^Ynm֗pKHHFbJM{gtizE%<< ƛ#D{ϗ{6BeQ>o1Xֿ1t_3˧ZvzMn;!T rd1Z*1#Q4>e,Q(p51=Vg@#qI^;D 2{S0OdC.IpkSkK rBLy6e?x>wM|>)u-M|˨r-! oQGg=dd{{-_D(C`~<ߢ^{˥V[i *n'=i6=PTD$:G@DNGǛ\@G]f8Hm[\`:0?9æo53GVPzinEjY{זL<FUuWO[Im!+ ̳+CBWev˾Fxd6UW<ߕ~sF{ev>Ti7>rF{1si҉xı$GzJx1TpϸL"t?*$62K zWSN"#B/$o}Ku=O \r{>d`;/OO%x;"P>C&Q[VufxajuU{9~Ytsp+խ3ɷ#wu#c?%u+y--,#^ 7a J|)5S6%sW8B:hY=z\\NGίY'#rO1ȡGQH`_1{1A |byy>mjzDZvD>3O-3[K\ڋ}&Ҩ$Nq>xg")pN8 عYSDDw ;۾\G>iʫ6;LOM(y׺(OzS~qݐ%ځZ($cѼW嚌8|l;HK ه~Ec _־]"(>~<0"$3Y8؇ܴ5?yG1LkDE:PG܃'O0>S8*y+Azjyu6 ߮NSL#uɢ>ң&FԌ,j8Pwp|s> kQx1y6:Hѐ~xXq9CQ|LwP CZm$(5N}Tr568l+CL-g>AAJ11mpR~e<7VI7%m,ɼ*-M)b)E|tO.[yIe2&obh"*TAW9\NR,*jEv,p#C9m=wR{#\1[u_d5 NA{מI$ tPA6nPN!RS9)?io'/14Ej9  1pQAi.$cW|xm!)V!H_ gۚy(/dꅑm/FK5/TGr>dljR$ҸW 1ivXO,+iȐ {櫳J9dahM?UF<}-SMip.c=h)+L ltg z:pxC`9{(GrddE/!zCZ Bݥ aEZoS\E[](P?h|ᐆɛxÃ#ǖC22FRc1&0>Glmv|s p=> J6b~i.ɭwf<5ڋ\*ޝ*J .I&z|h1x\긿^4x4ӥFщ(v95|MrD5>r:jl^qO'y+DbAh1?s/ |Xh7{ͧC,֒#aƝ8O>Iyahv9_+8hShkZԅo8ĔX掴xQNǶF8|ۢ_?/;Jcm1*S( Lyc)(_sc'BQ"" /UIJHђmk< :|3ti&mF89CLwi@ESZWY Ixդ$wc=6nGcL:~&|MlWk5a9{Z6A5Kϡ_7<+LF}u_?zF~F=Q~ͬa,I/ O*1dNJN~)v`~7ei@۸uvj*~vQl r6PX[׮~'f\VE[~H؋6Tm9s?{|_OtfzD kO0Onm~q"6{Cu5'v"s<`Ӌu<^9}lX PCۃϞ~S<`jR;HQJ{iK!C8tM Hov_~y7Gi޿<^ H!:EXGcZ<;FHT]B S״& P~efEEv؟nMVͷhk+-U!h~]5bVfbzoZmNI0mZ^(n8rw5]1n)'4SӮ,F; c䛃| h6GI-/Ġ$&nL~JV6 *<6ș)5 !Bkȍh*MTJiԎ-q+1 ÊڞbFS`>p>9`(rRp;u\+lo L{H6(! a ma d X4+.@Suھ#\fy6bf;yvfVsVڴ';55I`8ּСeUsXp"FgؾàӉHc;;u;Ȁs"(#R#ѽδ{c J3aʎɮ݈#zpv4=BiؠCZ5ʋTXa7L#@ d@s!@'Lkwz;uUdG,508 cpX@jUi6A͕”T22mm_2u4P$]iL/iɠɥ&.g9Cȼj==-x?|/4tMz_2ӂxvd/6^ibͨk.S#`ه^6ǔED>~O!M,aOEu,Ԯo̟mxuf܅XסiJHža5+j̖vky699caǁO-ukh-2d,lOBRsR꟔^k%D"+my1!(ݥ;~W__5R늛Yc_g+T?CP_ <_:~])Ukޭ[:/|x O8n<%mϚ|Rn}ӯ$Pv>ӓ/=>T-~Q{ <_ṗ<+awo#>][$k2ǡcЀ^g旜Oۙ NgGޓHϰ{QX^$I~p`9x'sx=- +al//~6DuʖSͷstS/yt/g#rX{\C~xꖨHO2=kZi <~+٘| {@u3I{={@ur|yɯ˯9jט>;h7j~גUuxgN򓆺6#™{a $%Du_sCUܱcGO(ҵ+ZiA]2kWՆoPw *FvϘy{=q#MSF!Ɩ TBԍ&F4_kzcH\ O1ƕD (`[Lo: ixDLWŗ׀}dXZP1.DLmv^;?7_3bLتثb‡f]vlUxaWebC J[!%.dERg',䉠zIM=9:g۲hq[Y>WhS@CY~?Ͼ|Sֿ3;fƱ G>ݗH=~郦ARQ@ +l1D 6we"WF8zgmC3 rE2K~D!!Me-3tKֻ-|x⠻^M7G}aK2t5mebML!۰.L`H!nbLȪvj dz_Sb\nƘb]QքE[—b@<zd?.iz,׍ ''%(z Pi#+BXuo42P1к:rCT{ⵔH;4v߶'C_-eTrGk/ |呓Q "Ix4 ?rCvJ.U{ + 8 AǓ$2 `)w%0Vt;`zq9K< |*?IlBzFUkj=&SR Sޔ52}N9yxm58 #ive OLӒ8n rgN? Kt?!KU5@^~L[WA\I*Ek|ʍrYpA"CdՄwXDnU'*8Ş\mGWM0BÚ/(~b@^)+m*lV0$ !rR)i82^m-؉qZJm ve`2vBnwN:d@>嫆рeU Su]J, o4 Nvf93 xdCr/ɭZ gU]şI8Fphh{"Z5ޓ0@݈>thο M؞v@ ekܱ{_HyOM"TdA6; ohM_I,ڟ (ݬf E;rgG ='XrGDAyX枛dR4[%J*"1}+D dh}FGߚ]wi֠p!{YrO6X>fn2m3 /ޒt=ޫ ߙk<ѥh#՜`|G<3ϪO(hT=_g)3ϙAl}SWՠm|s<$m==15Zk~e1PH> V{wo3DP2W򅽮k#̖OԒ]֥^}>/>Ѿ!NFl+L e'zf^6˭a|M\l;~zC I*+aߨS琧LYhi_ P630c$6A 5d':&p(ԫ&E3Eژ$< Aɩi70fUb;ЇGC!~+{}U5?Swv LM_v5UC^BvO`TEw,HpįosYm^BA?e|X'@:]hhK~9vmY ?GΖM T.V PEW(9NlϘ7F84 %/Q_$2n"Mx a.(]w~?kAӍ#&e> j\sT+-Tj\h=tjN${ly;,9tV6]3סxH\DO|aw.@f23&} %s^s0 s;Ag/-p}4>*(),S)ӧ89\XtH(J$Υ W=D05 !tV% SEҷ:T<ʈj16 ~|+>]SD ʷ E1nMBD1.c 2!Ea Vj:צCňC|4@=4Qƃ1n.|F;։ 6#l٫Ne bq(c<6 $f w4|EG|ȏ&+B|[I+BwL mo4d޹99'+VlιxԱ[ʻH}n~@X1|V(Z&JޱtA4]ؿǺ1<Ǽt}x0 \>'I @ܡVRBu~$\Kdwk8b(rK^~Ӽ<|qD|;.vץJ/~ͻ׏ٝE$vE?hjfݮ8ć6+ӯ%Q9oR6?Dyݯ_ߕ#ieߊ9λ-'Bd |)^q 9%v[##Ӑ?+Oq}aVՇ$PMƫ_:iϩK)@`{ 觐Jqğ?`HgE"֭4aBFT]ܯMzS]g2@?_~3#mPMcfcDlSOV3Hl;|GsY#f;hgdk•bʂa'1 dQʜOjWjsK8c;Z u#9" k_E5 3(17!cqm'Ͳ_E/m+-N&z&_oM*' l{-oͿ ?.o4h퐱ǩDO=!zkǦt!PsɖPM}zOKu:Ƨ-ykLמ\Q,Jn2T|$Xp'M4vmJ.o{V&>ԏ1䌼C'} )P)iEG&P7nb @w1x˾_zijy/ZQUaLƷZFēEMOјC9tr4zs)K%ZYYD@߁muKoLܖ 4\$#%WnDZ{[|d?=+q76/YM+ *|Ϩ7PRu$1ʊb2Xx?;iX!hσy HId] -RدpbMA5<>X+jfN !$o*-_R\PWim SnkuʉFzD65Ė&on/m%؉R[ƒ`;'NE*qM?+ DO Y\#!^Q5r˰b|GS`ZSdE);=:ᖟa%QPrT[]WVNORbxI VΛqOPQ)CR4y 4% m;W:a+ aszTM ^gLr$m`xxobԌsD~}dHPI\1 ?NpD7\ٻ''I/7+h98u3yyy~`~Lv$ԴRxYJHf}Ti83Q&o  e#WxlGcu#~#J Ӽ7JM{D.;Cqo2x$d;>DUH9_i̇tۂFƙ 5EJ=2m*hFO$X16QIu-x}Ӛ>eGy@}G<=r";i^m>g/,tnUAR1T^=eɏ+l+]AJw2K_eYZy =yz?%a-/$=hr/fbv% i!gzKu (N%u(R= x"!A@>˳s'ڏ/|'G䮿LKT/[sywܼO/1e؛VGg EE8`6 ͷe{CI"hO(ui;H"j3JIyzy13_G9Om/~K(eӵ(ݸgcDr/X J&CNmu{XuM*hldh::0ea:8A(܏1[ ݔus}jz2~R_ٸjy>~GA'Oi}=ZN.Hvخ0v!otyjP; fV9ٴy4yLb<{f]遢˳畼?ߙ56o/_ CL'}L};w~X?0?/+6wjhQp8$<~Q~(s;=P'e5~7^_b>_f^C](5h>)yx4_מl|CL~c>cP>d7<Qgf-, >A^W'f4X ~,T MaSu'cՐvlj7+0@ bKU^mpRqtqGק7JMppޙ e5/r¼N(-̞)9U+PUp]7_3bOlUnlUٱWeaCb͊6*,*VCl!T[2a(vlP*3"*8o`-yzTPCX~?Ͼ|1w"N/ӴN5ll9l6p[~R+^hHL-iN'$يgN-ؠRO*M8tH[)^D RE%:R` WݔF v \9v>er-d7aARNWm$۰1L1b(7;PX0pRNծ.CMqL} >Ǭ?%T,Bڐ|%[|AJD6˗Yv`#sIq:a+lh`6ڟ`ʇ9a$6g(lE6ëYiR)Z96Ge&dA"MF)|9$)] f],%Tu Ԋn|.f 7UQW{2V۽;`8c>nt2#4MV6P^iJU o1[~m3WBGѻ]KxW.! (t(PG\zdZ*zSS6<3AhS5i)@L/o/IeDCeu@>]r10{dQF];u`{m/fP]=I㖉i^YïRW MDYAN;||sѲ8F=yRkDP1fr mc*bT9fKJpEzV^FwavlVX$@T#mgz_m-rMQ|Gjo|5k)1zUzw\eqbl+^eD[&r"37߇S'c^]h|W |Fe(6}[F|w4,)W?e|j:q}/.(?;fm\\3'>I<Ǧzb`J=Yy, ZF>+/~DHnz㉫C#ZS1cOuէXt+1.ڽY/6#ɫ)X|930yʦm~sЅ#ilQ^;<w\二lzrqc$U;W=ӯQ|S9.e*Z)"dsjWCCti3H/M+V?j)QN\&c+y/Uhཊ؁3;=di\oB״MK_Zq GS^o+iwW!h?Kcϸn~ŌI49o͚/.mf *0U&ԺMnv#޴ȌW?.iLv+tf}yu S}dߧ\?˯4y>yJce> HSD˄Ѱ|l27B^v|#[h:94H_OzS |}Ww_9('~&Z@w;˒c 5|ڳp$%\&;ϙxLy y-Mvܣ@j 3>qs2kPRhXu`죰. OD"9_yI }v }]'䯓{4Avѧ[KpV9- V cSk-N쭵 _Wy琒X\xh\qLQ9t7+tZC:dʍ|ӤӬs5n4.J[5Ž?_Ii/cs?vdQ:1W~>*9xf Hm ,w?FLghK??TXɊk K-X/>;sy0ФendUygNޑ$5[~ҼA/I=y^M.W=3̨jz9p=>yW{Opf0WzH |bL kv6qkK_}R&BȬ}+COTm͖cwj5 b9AmdN#T3tLgw:_hbwr?{f}FXv]/O,tj'a%zfiɢOp7B-(@cv֙-.Qgsc!Q9y+&O1WyK]KN#i3*~3)N?71uO9yS~(i1d~ F3Ug[Z<<@Nd"h0F7#MuY喕GN%[]MuzNe)్(ڠe?3:: IٌSt==C Q#914(:_Z7]'~䵒 -K'`I3KRzUy{k8jryQnax(P~W4";2>2DZ&+($}Ϫ?('Q?/I1 {Q kT,oןkhOsyh"|t}xL eeF-2n9 Ȅ, z-")LӗJwȪk)nz%ii k\ȿ `6]ׁ}pJh\;M`uݣ#e#lcbTW}z#ɗIyۈ`O^?vp:#)DyD_m&}VBy!t] ~Ռ-ю3YE<$m{~4cu/4\ ⢉ay(gGɀ%njos $6HMTL%aCI ~톏{:YszQ- 63E$1wCnMZxL+:7_|m:ݹ $ӸD~pv< ֝rk^(NCĻ$* 7};fi鸧ȯ2qiiJŅ. Lm0R*Ь8CbqF> d*E)]xB=Pv׈Hj;m&4N3׍G9Iqlr1>R@%68Q0HmUʫ_,.IOƵޙ"Ԍu=ṟwG%. >xkC!]_\FP8m{P.ý}KɇSZQ,QVq煁K{D#[,0^܅ ,jFoc7ڀ(3ҟ˯DqS$_vbvhCA79"?>x>-S;_P~O_(N:#CF;} u̿] Q6n#z"#rRN2orlF K7d'iw&0I!f=GYY!8V;*W(+ӠQ4|&QHC26kkQ1^ԍ]`>y4zGi\KrOuȋ^1;{YÉHG7!耲~7枳a5z\MͭFEAkb^I i*Ikvψ_vGb .yG(򆕫Ꟙ~^~5)/n[[F^} cVӴ<7;G# Wna< {o?~Ry{&H9S"UHykuvuJw <3/~oҴnViZλiddF)V ʁn6=F͠t9t72ZUزHN%ǹQڟvR"Ɠ]K.%iNvUibR]#oCW!.qz<݊"F܉k1!2*@a,|<=RBAISAŶ9t {:^O (;k~`yCW-پC<|\3ߗfg7⍮[[!χ#݀MOn:^~t~c-htCBwbsöm9n%I2;%Y~ciސn)rvB;Kd?y{o?gI᙭5I?9<JMW붩T7+wz-΋!rGqQힿS D#!`sG$Dl`=Gcoh%ͅI4Fj*| m}$Ǿ$Br7U]6?1\ӌu?n~isٸNC:GOSЈ%?1~]Qկ&K-2?uw.<;tT} 4M2=>1D]x^㺝dˈ篴-FMffhGYY)e?Oǫ4DY,TP˩Np@}?Noxe `dȻWYQRrO_LGJԴm&̗ꪥn#* G]# > pp&FFdYM6RjT<-\EKa!g2d"b|+Z#tFVL"ndВx`kNƶYH$uFo{3rvrw:PO h!#>r::mj[%NmK@ضs`+ӻ[Q}]n#'Sс{s4zc.#ȏCS$X!<ǦM.RNA$SFj`pv;pouۛ$UhPJƴo ?OL8y (9_plpˌFgss/խZlr^:T֣bۉcȍUmdtAԴѼf4zϖ+%AܟiXv|~Q}B;vJDI-XnuC~ta:妩&I1k)v H02S؊5θ/A[tҿ0t˙ۭ*$? 3=&Qm}ozPPoOsxG6e,#oNFDGZ%PӾg(umZYJ1`V*>z8+eK,g7ڌ0HD2`|Esmm[YEf>PL1~rSvK6GYW!yojyQԝ/!%]D[!BGŢoa[m#ŒBsEy1o>yrW",͔^( kia_\êB(s*yYϢ\NFLG.$P/_*|[yvɇq=q fNu˻/ "I$¹4gğ<8,U'LvJu!&u)TvĈݸ(,x33>[o}m X̫ B-Fk8kEN{8z޹! AM,*r\I]dM3n"dΖ\z-4qp;`duB.-4XP:`d-W|v7_3bLتثbV-jxYWf—f8*nXB2aPlRQs"*8G2.vBAGOaCE c>Sb>, $;L퐫Rl3g6yR=s.(2[~ipb"sQɥv.:vݎ"$cTW߇;(7‰cMq,sHXydCH1ضnKQ~7 7Owc'n@ \Z@j2np5vIى!d8+tM-%YG ݞ5?h{9cÙO F;_]!wK~14Za~:}? ߦhkg;"Pr#Q "G"q";FVBx돆5lBV8HP`~*~$ r)_ 4䁶;d7Kҽ68D yd ӱmA2X%a6@Ď# ?^Z͇@JT@2|Kƀq_>q WrZc`ԙyȵ64;mL7RΘg>LvCK,"5}rCi曋yUVI3Z(Kɺ9Yi &f5_O GC^4A lV1Pb'@ې5_P bMS{ t<0nO_'}|3":_SS#s}hDT ?+ (pD;@Qx|僳z jbCʚR ءҒxb$)-3ٜ}7<5YmI~A=:5x_ Fp[Rݠ xm3#z4YEo4I?Hج5 ee= |r?)N54b0C@64r:-݁ڇ ̄Ek3:( Aw֣xjuZ/ZPyX_~G!cVAPb^b#<~}oOhi%';cg spj2@G1?̒>ntCMRZZ| ,Tx=`==̅xoQ᛿iw'x/{ݧqz<_W~\ʴiw?~`?741e$z' њK 4N>$q Ϡp|<>?=4yqrʒX] =jz>}C~#i:mgI3v]CMَ 1ܚbr&X^Ű#zl_v~YbiyyzHu嫩8[ܚUOO c~TjEwv76:m:#=:3;eۑpa0ww49,K]VЅG v){Z9M3'S:?O!ߙl AXs]2¼r2XB1HȂhd׹by_'~\fUHbo8nL {˞Zޙq1߾XIEmFIw$k>1YHrg񳅇C!2c/M~I_ sj7`N ƔOk$^RI,CȒFB%o4aJ&1Lv=󮁺:, \O3CK?do8y%m51(*0Y*}Y'"5$/-B%VJW|bv̽302FXv>>hbe cDx?fzƳ?= j:q7JolFP &УW"Y~]yWN(o VaSOP{g` 1~Nnϗ}E'盟o&k‹ّ㝣G'(]G`Nզqm\/8L],AytU*fEq>.5'm%`f?=?'4_ &>i&e7흼Zk0Jj3{r<ͦvq9Mi4?Vx4[IQ'd4Z_ҕ{X&rjw@l͈cF EVλ.bz͡uVG!"]JF|:„0%Zo0a/\\=W'h}=I8|[Ү}DDf[Pd־Q+A=jbԔb_eafvLJl vɏY 5;/U&lJ+x"+):cFo:K.K$|7C0-x9EX)\_Zѕi)5$w "0!cqԃ|sGf "DW{?٧E,. 7|>yQ [w ~"P´!v'tv+-FT<>o1^㊾n!&tͻh޻2[=fn@w)=i+!ov徢_. k#{aG=>H QvfSod7*wW\:mv dxC!d\y}m! QIa^$m3P}!ȞmA"PO<_0A?bH=>;O,.m.C8HyPV'Q s@#!յh-$`J=ބr>{kK6N}>A>j3gE`M+AM ~L3;l16Ǿ*J7႘#< -F<nntfv0" "I4D$le L-/2דD&S}:Φ#H#v> 23/C?&}cÖo3wIV7_uϡ{"iO*3"95ݳ0Eo-h 3hZT$Pd<"<%p/!mpg%91oَjyxROl~^_/qHv>4Ay&QD}U9-4 /G7w Z723 dh^L|J0B*z⌋*қpc`B\=FB[X#LceA;Z7_DD3"{bQ+oCfS-;5IREtE@1i%>Rı#/;`(#GsY~T\X-UZ $SOe)PijDGso*NDsjGdy{z){ХB$#T5 IˮyIMX웮\1>.pOsA̙ྵ>ypwW.3rg |E|{}7˶ d5 TQփs0{{P'ÉבyD;9N`@;|{i[{7/#>;(9F@iÈ;/߰˴:Cu)|c_OCs6]ju3DcQ&EdtU.u1ƼL7o۩9̵ ë;UWu#QP+Ж41m.#E:> (2OM %*XSeTrjv\常nL܋$֛RX3wD9e'C=\T0;"ӠxW"Z]\E(;YD#+^PңӴXd#UIsqY%hx㇎<8 I[Iy- ?vǠ@8?N'dHdf e̲ą}jjaH؞A$v}8*g)}bHF0YR%T 128nOt7c؎'h{cN c2@ޝgf#џ3XܼO£j{LvVN^o$ W ?sV8,O\pv|fCpO4IKtGR'Qw+}F֖t[:yB*RB&ouy{HaբgaT7C>M6sg-/2 SGV?1s .Q΄p*3~fj`KMmo4Doo| e3H1MCJɑ_'-?[gv;=/-KK{U:L}Z X~ovWuXo$@BMnG^ÎZy WuwiN=< o^T.~y*MW@[,p^Okʃ\L-nwZ!ص)>Gӊ7vv5#L N1xت&u=q);倠c4#`0S$v+J5a7nPq4^ H[TlA5ӳߙjyG^%_ 3}y2Nq;#~lg uA苯{_6Xj?`ʹO՛&n淙VP)pvTg8ʶ|.ɣA xh{Xy]ncYa y`)u-A;W3د7(!#qSؙ%IpuuP>yAqkewPzlERPt֫1MI~#5Z}a˨}1],ZD)6Cq^h~嶥ne0'JJIP{v#mC톸OqHoɿy5:Nʡ^|5{ueggҡ?ݤl+Ӽc (M:`U?fl\'˸w?'{qڣ&oLG|#Ig_>NӴ3u v7?8(䓾kt!'X=^v dcAqW=~y؝s ~~L_^M<yOVu]GG{2_Dz>>yK~(Xf=8e@Qƥ/9\=֯XIM zhp3e_Zdi b#=ѻuӗafu}`cAN/T/' 2Oݿc/>!-yU4K˛iB姥hp=ߛ\G}yc賁 .@wB,eV=屺XB6+Ags_ #y|M4>CE1\ ?Ec]@e٩э/{O>@}ByOp-* (eǒ[,l07r+ݝZO9O:ut?p" &WmkzF{4-JJ-GDz)y7'g^SaDw{-ռB:Ϝм$ҐRu-;!aVknW!gibDjvm-(@z<"mjHQY5b~h:Hy,(oiD}e1g_a /ᏼ/ݳхΓˋi5AW?#UίM#QmQu=^am>`wooOyڼgA(aYe4-\y KOį;ysG[^UWzQ#AEU_v/EϖeT|*]ʌ'z2)oK48iQv¦Z^v@lq*"9}$>ˌ[Ko dI˄R z{cKPա~!اmdC3ҿ:dx%Tؙ ֕큉D @vLB5;C)}9ɝl~;$mFݔ-mƵ ڇbmhNI|ۏ\<[ُ`}s%Á=FXOrOS(F?R;/s!*|U)@P66Ȏ>(ʍl)Y,27܋aP$4ʭ$%+%tڻ ع-aVT AZb||2cf)DiPFA? H*lU 6 O!'4? gb ,bzpc"n"OVR۬ mM85p"di_əuc+ sX(|F QaI!P׆G5j˨ޟ,el#ICkBM}jң9cϤl({b*0}th4&+FIU'В~di#pj*b*ar4h3&K~yR#ӊz*xʂdP۸v=P>&1&<@aFb(OQ@=|pצrqml8nY_KF>$w`bfT}72Ȁ; _:Z#K[ny<@6ב'3'¤=fCwW'I{iRV{n ~ڐ/AUy<ߚch>oYU~z}ߨ>psKѿ1-Z+pV`;:hDȎ8t]Y4r[O+Ϳ7; !]^֨>]ѿ 9G(?#-e:nKWwffolg ~=J._73Y?SvӼiH'ͷ7+!cg2ז͚-Ək"vLs[H⪓HeC;5K&P'4yϼẒ)~~\y.˿-iLՎy%ڤ瑨G\d[6q0kB|YΗ/?fb E:ohQ&[LFVզF:ƛ={'jLxklb׳$t8?g??{ 'mWG h=GeWǏp/ɍe4/6iw&KiӜzm_*Ô☘?#n?65+jvJBn _V%J{P3T7vN<A﯃<#F y4jV7q4}Q.u#]KH3SSˇiԆB=Ż_EgbA#J/<>]K}m 2K,dY zN5i˩I (=]h"q{?h~KqܾoC pnkjS>{Թy~>A.M593AX?CXϠ]^y{Pibp `½Tֿ~)^bQ9n ' 5tZuXN[ifuehj?xTӕ{Sm)mIm4\QvU؃@FaiD8GOCyT 9 %i%zdng- ==Gx%hA]S'wQ}N4fs#"KO6h)|B區@:v7|7L_䥿I?nv+Ӷq%GCAD_BA6N$U֕8$sr4eCLXpTAp4JxlwJ)Wb<l̋Q`])%&\64#)%s],*k R<\mDkN@IÞL~s 0WC~5m^[?eXojq-fpЭeյ%2#q Tz8n+%W~~>hnB/==Sl;%!?:m.ie ."qrKd?dSGKulan(`N٭疛Dryd_4i4)4s~pwi<z'rĚum@(mcB]g5=O>OW766~!C#J% y~P7%jwY9/ՐTZr`x)w)鍟=e:svm6m^{ ܇O1.!."uؐrI;6)H)E3qzId˒"12q'3b m]̫6Mm&{rG:˳1c '8ֳ| `cA܃VbzM=I!>U@[ѣϧ}| KrՑ(a,!2"sm{sEpv,\aRw-,~B2wv!"wc'2t(St}{=GZxN IH9t+F'߶NZ4c%;~YT{d.[z%j 9 ?qj* {mW 9J2f]O'-{rWR+cS\:AW@0P,]2!]UjԢ~_"HeUf⣮zD8VIeXГdעXz==㹿H G掻˻}Mrm}>Fm9y|p3N܁>S==~YOyc=zbbI&^<{[=Vŏ@=Wܛܰ_6K>KM3qQ;{?ʉayRSаُBR}GN\t#.OW&iof1$5$߾|Ĭ}QhA/+醓9̵MAn3;M#W̸mg#0vNZBL.h v,Tf$O Wbd׭>+2)ӥ1WbLK>_|7[Э(H*r"3Oi8~('ȅHTYjQAV="h9v&< P oqMvDGTJ~OA J{|)m27 źS|d3(^~eev" -<)2,O @_ex7DQr?!j51Õt6y6[jXHn1vN |zy,*@:!2bA&WWlO`jiZjj1q2F̪q#0@(BkZ4xǗ{`.3ؤ"y8䪴-8=oڧM-ח`Ye`dww}#?O4ߘ3C)v>nA4~[P?-A.|>$?κ;^Nـq j.;)˵P|+ʸe:$_ᴹ99P:eaPE##",nTw,htD # fzgqdp > y&<ǡ@ՏFԠkH%lNx Ftϧ>Hƃ7WFCy}/TN?Η{}J7 Oo2jݤz5sZ_--^ͦO:v~-=+7 yd?3ŭj<Uo̞\LV -F0x^D?"%O|+~dۤ:E=ExI%FeفFjrT,p݉}QShGI&?9yD󟑤 hkӕ[C*Ej:e&9Y(/O@{#yQUŸHEqa >ܪ)ƠӮqX4X_3ztCrP-Ms!}>eې1Ϻ̾ _$:3l-4E>@-yYF{I)X`Akܟݛ=63[!GRam\ ,ǯO2‡Zd65uB,n/%h7ͷŠT9:f{Oڛ9>>&PQ=nSm91#KF cm?Ӕ$n[F;ä"C^t Ch3壀$(0^R -6E CS#J 0ϻf4VdΖ'0%o\x u9n.9@!G2<,rNxW`rw'"VNoekx$8d 9fCI^br끿H-i%lj7^kTlUث(.‡f]vlPUXPت6!V68dPtU?LQrW7L?2Oރ_aC밿 c>oTdjO/N;g7Դ'mٲ+̅<4E<f@-l&r@_6S5o:F@+!+;N+L$ f\@.Ǭ\}S! RM/RӰ^6?Pfۘp!\mt5Ld#~bvv:+?]EY~W3@}_{Kga1Y 7fi:$Ӡ[8SOS)벜y|ܝ.[D6sc+ĿmO0oAwJUF2ʦ)nִ9 <` T hsFSlrIg ZHl׹DnVYJL`-0 Gll+>OLCxa11 )jȅ3lެH%F`6lFTӭ? ID'GLh'+ \4H$X(Iu)mLr4LLr"&œZ}PX}XM:`7n*q]xV0J׵6؁19 mk`w;(K0~o$h9X vn\ ۨ1pyߡʜ{\4l>Ym m8zbkCR7ȥx)LP`-ɠSӒ &H ۦ B ҇&wcf$܆؏lIb4)qkbҧ;_e!}.ɵ*Z]}Pm]ԩHˌdy#oIm%<u76%RqE`nPeڇSqsɊרNdb,P[ #yO{1yNi}ZXխnyKeϧ8Pfm||.BSWvjlRNc}ai'O˖?Hj f"cl|:~?_ R_8BΪZ(-c?d~(laZL[?RE$E՜D'X}9|(xYɊ_V9}?x#7yzC/;:Z4b<' o$V_F@78YN+|< 2sc6x͠'$F|~Ril{_/ϫ}nwΏ r%]8xΉ@;Owl񦩥h7h崶$/_h^Lf7R-bC,LOpF;-^nQZS܎̈L1!gןM<[^SjZin$(꼎{S^bռm48DWM*Px{WOZ0P>X-!$Ӧ/uh%V+e&8Tiծ5X]]?M)KS}7swᙏ;9{woao(ɡi{]J $yb]@E?/[=. ڕ㡮~ʵ9nKU?Lz m#o={zLzQ'n{z~o~Ai1ixå;;YdgQ+c*A4 ʙ<-Ɩr&fU[zBsOpHy ݮ8O>_ߘv^ly4>^ZBT4e |s:TV2>E|=yH,q[_/Atc:2 >8Hsmq~m;Hrr".I9tC/hp,{ 1ޠ3נB/v , \,Joi4 dt䴑=A[$ (YM<:ۡĆ ҪOQ_KyNq<}9{E. Kevv6 +H+F K/G\R|.[+!hIuq\4Jj}5HG_ !G pm[4=|pJ3 %bqUs@+f8}kf_x{e%,WQXNǥ S~#-m1|yy/$h4'A:g%>65͎Fb஬~wHsR iҟ_1>]b<߅7N-Xpz"~ME3|WsqW3#~s~JUP 6eN1=TӴ> LjKW4ElYy8ҾdY:*nz{g8Dq[>si;v,GtX#_j*sg8Gr 2N=#SCa'sA$eC:{ʍbQQ,>R\#r>s=C䌲Ne+Z-A"x<*0T}^{ek_~~:+~X:N>(1S*FYfQ79"ZYzimyn)zP*Ӝ^|Lvt.\vQI\9zLJ=Ysڥj mț rOцP' Xq&QDDг;ǧ`iJvt:BC>kɭ3/4᫯+}WI[[;=)>zz41rC躭`@=v)㱶Hxo04GO5Fh t+)4̕^ɺt5KU:qux"q> 7Wr>ry8Q-7?Cn<]EvxNHDѴSQP53ˋ0L}U<8da+qtf7/?9)|2=VKv2lGːH:g[x䐐M#7|l}iԋ1O]N+w?X| *>Хv=s~{hv_WVc[k6jeY$ <;Ul~b/rw"qP3+^ּZԆk"IRj}VBQN5=㔰{&=o;%oG̺~ZQ%Q׍i1gq3gkGG1h/6ѬG;IX Ooϔx/ӐMG̗ xD\p36yw~z4ƣ@Of?ʫnoL?-(aadgo|OL宕S=^ͼjz ݋dO/ϯο0pݴBMt>ɐzvt}O̖>^M~~}d]yt>&մ&$R!Jv_WhzW"Aώk?X۞U8|? ΀yeB=iI#xG͚5_ٮ?zw~2zf9wKݭ%Ei[sެ7$gc=t߲0ǃ?d'уқd -u3f!-WrvkO$۰CQ‡b iN"@$vSP ԊcJx'FL{SKv5qK`A;{XbF߯"B9; tqu7mvt8Ϡ=?'l4d=tGu oVS+)#)nNWY,7)?$@պj6Jtј#}[\[5ÛiUؼp()#͢Lؑ5F+ӧZ#A׾"ƈY\RGȔ+1 JT C.hi(HTVApdFDjW(>,܃jL4rc4_Vv! OM `p*Q`LPvUb:#x{ul$>^4OT>%6kE%'v$PǾu'2葘Ǔ տ.t~4"YhTqN>F; CAЬׯ1?):a.PIĨH #"0 AVidCRztјߓˑ EvQE վIJ yzQ4KGa7k'/[ ATPr Zo8M!% 6P;l#E²Jia?Z(k{":#]5!QJSΙ|C /FbA(4;kP))IĹ^*xMݍ2j&Kd8Y9za0Nv rGl 8 GvZ8:ժꢠw TmӅ$FuZhw? <?{Т -|Gg/8_Y/躆o i2vb\kcߘmp1Jv>h_^I.tk5ôcS1DF<|XDŽPI[ivQt (GZTp$m߱PJO$Ih.%(Ͱ7q\?n4]0 G]12OOf4+IĖl/('-?hgKfXnIsu(r?2Htj-IXcnOAp nfk&!&Dҭk]Ӽg&Cee,O b0-.@^O+]Lj_s1Y^}ύ|9Ex[ӥ4 2=by*Ts|ĈLLjVc˭˞\||M7es~FQq l.?!4;k _6+[Z]i7_7G}N>]C?7w_3^\j6Gh7̣ Ǜm!]zuNGAgGo;'OϞ]~N_iNA(l4GP]'D/>y_ȱ|?QQ7$X<yIu$}C |+Q:\;F"Gr@~z\5ӎ]~_?]~jLi]>gh\d|,!מWՂ J)"0` ]֔̒2bţԫBAQ`/U|_ξ+YX z|_/y"̾]% mL U<ewM_mfm[``Urrg ogx Fbab?X'C6j:V~eJP=m9-Y~\Tu+]ZO)+iLEl_R|> s;;^rok~R^I JigW>M:HU,軟Āt#;א􈴨hײ%ԽwUkf:5y<ߌvt$Z7T-$>YqpT޲df*SgAᓓx >!R8nď>Gp|+g˳]&=za0")i0F&g ƙT@:n/Ll.{ง ;aE ィr$2i$N2$%gr'I0JJhHemō¯M4u6ǁxޘ_ lLc+J'ɫ[t9׌تlUٱCR(vlUٱWeWebٱZXr X C\`u9tXj0ܨ0Y"Tg9l=Q_aCz- UXW>Ҵ ;6 "PzT |M[~MxB_G䠰*-Tbr'*{ НrmZ>n(zR@Jm^WbyUA(޷ZuiBֻq~8їuJV{6]Y<27P } dEĿX4XpO&:Ę.m~,W! ?WJyWELo(2SǂթdP+oyk:Tz hpj)V;|F.ІcXďo緕s"5 _l%@$-懱qۚv{&u}Kr-7zUwJoL}Ok8gCvdc .qwtPiK}J,؞q$gXПO-CM|pɴ9?iv#<}vVZ=:\9pm嶡e8Q+u=3yI=ڼ_9][Iku4w_eøuG|?)y\lt_Po]?TscE~u ~ryw̶^SzXjfRW_NXH,7G qq5uwq?,as;HݐS}QS"4`,1 p⸒Ybbe$GpGB3.!XT=Y91dDG@&__2X2dpɉooa~INt/5B_F^46=uΑ?$H~ieI 3KաaRJӶvػ7x8`)"8SH8y b?^rע]KM2[[nnrbI CXVI"m*[ki)Fus2y,L~ò1:q엲84|~,|48b/k!\(iLఊPL* JǍ 1}nT?*,^DB+CO#A!uYe&3;xp7OWWz8."^!i.K!0]n4[Ts. Ĵ QH[7=a<5!gߩrHw_.yyn`_0ZkVS4>%>u4ZArM #=;HƁ4g7rRH; 02kនwM^c9 qC&;t L9z̸Ƨy'o\HjZ8gtݝh=_W;o-HMee\ J(`3[4ڞv6/G&28e#$\[;sé|m3YkwhE 47RĠ̉¾!aMТMe<,mKW"RhެkujorәT98؝,%1"[K*RMpJ~ JG3R` z\'6&o=pEgo_"]@R>wz~0Xeޜ݀`.#~f2d֥_TF$VUaK!Hc\`ؚzvgZ!/UFp[/JLz[~\yziw'dbHW>uSn0 b|@'5}(܏"j w=$3CG Udc:Zxmc A@y:wqӽEXJ{"?0x̏z[#!D埗[In$[hﯶTƍO9.$t́ߗ&\{ޏ]j2=2Ē>b?^[ˤܒ+ÿ5nxxGvv&He&ʬY$qJQBo/rwyus$z;'0,DPR6߮e`@džKТcYT ű觏hb H@d%~ll EV{Ԫ4V$} .FBFaj6n[XjS@֞,JPq|򹶎K?a!Q}8f_Q)T}KvftI?40~a^DaYXP xs5ɋS\J| G*x#Ҵ#=WyW\Ӵ/=Fj/r;Om}s޿Ӝ=`l{DʿS1BZ"{zn=e! ,dDŔV)%H5#N3(N˱oͯ3j6Qѧ,[ܘa'v[YP =FY` K!;N'n4r?LGZ lmgyz^LV98%* o6>\od!=զUOPu#=.X'?z=":l5y_ʝSB_BbAi.J?`߉ޝs~~jPk_`DW]N?ؓLԍ^.qr_Oϕ7q@unQ;ٍ{u8vdrIċWbs9i]۶ a"0Pyw==akuxi{ce9OAԕ _RC>&ǧ>vcLiN)l7{?=>tR^f3L#G9nLdre 'ÐxeN^aEiᕞlP VaByuE#$̊>ݱuJ᭕7 vdEH~ )lQB?rmdWB*?.7%t*=NDEcIRXCcbho#\8[nj9.rfdKOIz&'Q֠q䤁O tD2$U;K~'Bk<>X8[CϷ mz]OþG%٭UԪiJRIjy<@z ( :i )kk"lhY-O#]Dm\ܬ{Qv϶ Sh ( 8>* ;ZDsK&p>Qژ_R8z-XF 1$sQ3|TjgLGg䵖e]gP>xyoMvng9i3Џyxn=֒Yg~pe"OMfOy|PiHESyCH%4rr=]_:=Gt/f:=K^'(Z48ˈE>\nٝՍD8ŀyэ\ O>`m lJ?΁>O̟"\jy >ݽGRTwÕE ~Ϸjĵج{:xP1xMEWomu.IZ7<βGz [ 䟳]}qoRB4Y װQ̿~G@@Bĥ寑5šq!D-$86 }ouMzʻ =H~g7KYޟwH=$A73/RIAs~ Y^-N\{+AOl>'Ąy7G9!C WOE4g@'K3Tf }jT*) kM?JLsE1#G#fݍNqmk_#?LM piVswvM(AOJ9[_-y]U%~Į˛}'"Z|ќ6M!$)yjDHTEy KHGZտ>(|cS]ZsCa;}T̫c.W5u;[TSԛ;gI$r7y[ӗ~?k=pD@5_[woh}9J[ ?7k ?Gl{k8E Idzy])hcTjK,vMy{7Ⰲ;4XbP*(<ml:SH_'c,SSk{ X7GF#l{Q{ZgL"Y&1 YUckhLxQjb&^pWbMrV“'l<)EO]&fȐ . gq#zk֘xzx]W"b(;6B )k|uY Qmw7pV)9s6(YV隘QN6*sb]]vV(u1Up-ovHE 2J3=N_Z@(q2"\󑀷fm׿2k;gB[~3쎄iL 8#^mj%̋98Y5̨nMm0[5=N"[S5o `摲 u26l4 ]FmE6FN|Jv8H߯Ldwv=dv TovH/H`^nݑ υԓ_LY {*ezhK-/f`_G-HG;%zgumL,ڴz TIVr$D<'hWE M[nrŢ~[m03^Sr_:hrqe}8:^g]7q*>SEkxmIFGFqRѣj1a&B!7rǒ OrT oPS#iEE&bT4r14" B϶>i敽gHM:b\RSlm8z+ 0qDW :nH+  HoPЯ(ړؿw߽Awek*G\枘 C#.剕Cb644Ho-8m*lv?(al!>ԸrF N}0RNTCQBKVp@B;m8gO0)-P\l?+֘%*AHT39oF$҂};B ;')UA i81jMi9`ۮJ-4gM>_fj=>8Xڟ v[OK.(|GC|WizwfB[Ă*AU)yA?+ -T:ѺP$'q \Z=zvVq1*"eP"ھr~9/ME>&)dm|t;C2dMn@=6Oᘶ;)hwfӮQa؊}C72[ :Ր yǧR|XOdg \rC]\?~\ѯ ϗ.nUefmMUCwğ7ʺG)!j6eOPj|_krw|9Èw+;}b~6lGy?A:z9{+ 6YWvR->G^~w.Fa@̊#zUFFz7kܵnW^ Ȟ}>JxqyEG{+Zw㷟ʣQ/]SR,pHd85ꖾPeM.z̼V2z`1;J|S䌨c@4##7J8ng+$oqyb GӗLH\"ٔ u IyB:>\e1DI[*|? v6m6!5ҹӈ \4,0 )-f @'`HyqQ+;,"OOJHT337K5T`9[D{B4,߀x>&`KrVmNOKMPff= .{Gzյ4Li$]YH{ 3tQ88cͲ:cw~dPS~jskbl>&UxЫ9y зBbQC`O(pQQF -N.*,8$?B q~w:PXV:|m,Y!*tn5uZ3Da\$Wz>bM{,|~c}}K 'OH鉜u2p)tx^_>C7䶙i$Vzwz[tK 1RiIn?*XouKY1;po/y3zlM*C^w3ȷb~yHnowmAcm߄.VTC$F&t6yLmI.89&`V P|0$lRE:8j4luI`tq?VVtD)r-%+\j9>_IPpUrc!ܦknF74%7kZ(I[@w#'MXa&j47+ɏÿnJẗZAb*~#*~rK-1܀;giEO1"K7T `s1 {qC/m㯒;z*=݀Gyj XhUtM^դ\Dt/˽9{xL@րmȟ ֶE6&6ν J8u-}$]wyvݞ9H*$̙'yxx/xf PÑ1ga*%H Q^v93fO]~K#!BtRaݮ,Wᚄǝ54Ȣ͸+;ւ5UokC䜲Gd1]Pν_{W忕{uupk k$JF]<}t\?M [瞀$g!Ö,^\LPAjQ8rjFqg<NU,Lx>p9Ow&ˤZi8oVM\:s)Ef X~q\aL.N .VHX6Xھ5F?9lq,xo [/Z ϐP!;I?o-뒮+Q% Wō4pӕ#%h@rN 8`aӶde@k_f^/vH#.!^bJT 5[,u&@}6YZq/,VQa"c+CJx?бC&#+u8ڬ40EƣwDo|h&Gdj"ywF<$ڷmt{\äi@zw1؛H|8j%qwjH?mqNݛ\G&l8Ȟ76HgG!D~z454/tβܸ Y!_*:Vmi-@ګ"$pcCAٝ N^=wɞ$0ܡ<+ȿxȽ&2 k^\o:DAX7d9 FjJ3t*ͧAF!'L{Gr9dwsʼ?9tw^B1!Z F%^T圿#o{w=p+s"z:9gc7(Ԉ >xIzt%dɷť*&Q@ǵ>ӯNfkq2~W.S@ǧlvzՇ"!1/)Iش9tڢ?Y}yao>:eQ дqMWSUW!7Ⱥ<^yY\\OMKHN8-ґ'{< 3Ϛ8ASLäp7f3ZH V4yE)> =J{e3և~^8 7./6?=飙 ^_T/ġq;'{񧞧7ɏ7r) 2A,r̶m@S)7uuv5é4-j-If=OfogvV]|1 =s4Yg<0>nG}M<[rq8Pܯ9o6~hyrӎQd{=S{CQ ;˽!8R^cM_́k؞!?"VD58}%v=S zLZ}_8,Vn0:t~E' s?53њݑ W6 3'aވ[Rjbc|G`{OO8_4=:~dO,5^"E;5|)F{`{Sh KO>ٝW:Aڇ{q#*w㔟;ðtsxenhCdEz戇e&L7`}kZՀR fv(ǃN.H .TP. ϧl?5:SܞQcKFqx`G򄺻[pR7Q|Ya}y?ivNПC"=VXblKtOpŃ 51ڕǛSֽ~cLD6R,> Պ?<2P8PSCȚl]RHXҹ¨i|@kLt~V>R&ےƿNy>)vYKF?m˫#O|W~mDCq4~| ^Tރ:] 092f<byz1X1awNp?KME} )\9D 23)o)A )mn(l(d3jԟ~>?K }D2 7fq{-*aфԬV˷T|=Ğ_?hYj&1Ù{=? r#{ٯsڟNrTL93}K,g.# I*5yX WbApF+ Y_V~*1g iA{)+v샪\79}0wa8!ŗtv힣mq/b'XJ3zbwЕuL<_^ FAmli#eLO=sŦ|R?O{ xyꎏ_k?1JߘA| BŎsM2Rmte'eK7NNo2(Ln͚8ȁz 3Goo+E%3>_z]ؤO9=Rqd9W̾L{׃]~yb|* ju94(HZ]9SІ5`am_jG%]?7}wnvyi@cvs*ycXβ:uV5O ŤV_s҄Tr[6Vo5 9$DJFR S*$Sݵ0c_vX'*hh>X+ o5. j;b/v6Xjy"xv9śK#"?Isuv !|"cW&+7|^=)c(ٍ#NlGS'D'?6-! +laä O-.,ؿM%s<?j3^ZUלVדݹA^Os@GwhA1rԉFe qocCT1f9+5I/롪h>r: dYoBʪG(sKHqA h4D17W Q+\1Džm`7fU~KmPG^֙!KSM& m+; / Սr$ZpLIR5l)?k` )W ?7]xKkb]nҪ[ap;rB,Lqp$"ljwD=rLKt! JLxb :TfDR˜_rݮ|:F(>z2v25?;@g a`sm£nMֱz&9p$g6RtɓIrZ- 5F!0eJ>8\Ѵ 4 RkcnFSޘQQ׾!v_iV0*8) :HZMᘳb. O-C'@뜳>iޥn7l`qiCט<>cLJ<Sxm8hڇ^΅%nLlyɲw'r_.ilcok\^K,Tx랩5)%54nh涘U>ԎĀf|) э)_R:@"2't8Fȧ^lSb0XnAt.&6sᆐ۷LaքZ7PwAHW07I;A{WQQ#+@ Q|,Prcev ZHU&YRҴU51F>;ӧ#͘:O+'jx~.kq?1u%EnUw;59!(C{31qDXmy v4]vW xned_k-ȷt%C(`hv/?y~fshyst(yDi0^'Jn~gW/N(n>1OWrR埳bH9j hGo+j0_BhUg) ~DGGOę1{'y{DޙiipG{=OF6ᒜ`>Ul&n(9+A$!౉eHaM`>d YЧMW:fc8!##K \c>`qk Hڸ"Ht>4>ڟW懓Xϗկ-וjLWyr~aֳgaq+ԬO}o*;0{7$vK{EwHT;a>Ώϓ8X$u ?3^9)mR]T =ZU*n{Ƽ"PA<~i/f]%iT~w,ǼM|hu]H r8_jP*֯qHT-:]s̚r.ao/ ^Rڕr{fV}FMTL3I>Q]|ϼ@4O/A2둶}usyfͳX|~ႛf?u4hIAsK[Zyin늊HB;r8,zݎhl,j'h(+Ou}/IGFqƽx?ޥ: >ѨϨRq{ 2'u"EFlia$Λs&2l ԝJRGQ'К\A@J(qŔ\;+'m϶K"٩e?FE+Ao0:S`,Bw Wl!mY8m@U.$BJc=uԥr'f2-*|amBJ&.hm5 e@ֺFՉVLL#QY󝷛&pgj>iqgqOfoZ-%+/*TF?OL pP0Rh>5fax6;a(";*OkMz4oV6uM$(Sn#]:^2O?M)M=MT2p&}Q!H=@i:4J@H+]];UBK#U&i) F"-T q!W DiPm`EAś@ש#oK l0ժ=0mPS @XȰXA4jݺ`&4p)핐.")m86+\"6;aW4Kn!$IlcM-Kn(<2QjR{eK X8{tlPFx)`0=Bl5& J_F6`*WokL-Qfv$"+=^2e<>]Lk^j|{;N8רݨ+Md,v⾣bIާ[?{DmO/w{&vPƃEM߽ztj+ܐGsL8}Cf[|Y2Do6??3sJZ^Dӵ8,.u+ knGzBI7,^W+}ۺLs&$ |g=kY-f*oA聯Rs;XZ ^K qSFm"l|^[~:6nx|iftVPN'TD.{*шPu=Oq4cc,CmORPPc"5c#Bt }*&-bK>"ؔg*reD}(_~2f|]cMWx얶vK)-1^|Cc~qǯrR Xґ=1I#{djimSJؚSʧRF(-y -Y-bvcZPʵ!G?tڂ,=mR(RG0ƾ_K i&"mx`8б^>?R4IWbCRBydvG@HȌ2 m7yboy|V"{Z~vKZC#U Y20o͖3]J}E].;ep]w7iۦgvMFQHBGXk [;o*\j~Jaj5{/7bДm2ki>qtGmw(@4rBWs̝ F@C>~f2/.VI WCw!.n4Z-M<ɥYyL XgUe^v*;{3Q3T` ٩1lpv'k?xǘ51KovΒN ԣ-@[~Puy] V[s ڠ$Î; َ8)$y3`49||TΟ^s_)@+]GrjaBT1zL+U:֗gɈFǩŏĄU\sG |2 K X__˩o0_JXGzB?GkߺPt݅xW#<οRͩKy/dczm;M96}Ngu4kB?.y.O6iR Z秹GG,7U}(ƻzm갥ֹ/)y'EWX rjVI;ucxe/ǹq{SOw̟z$ClX-4Տsq°z: ~ϻۮvN-+ee6qp@!8P:-8c`A⦹k00HWlι) GˮVdNJSl B-@)b 1ONd m%gZڝFDn6G;% qZI@AzCT#/q*Mr8ָ!<8U I4I;~',>Jh6u%&T!ڦe7 Gq]p剕7 0ql cp =I $)JcO?khE*m$ҿoC,sFFc%7FqYYxTS}gXY:~_,GK,Yx 9{?u:SXF|gc=P?.5/eReUUk].鸿&)B0Mƿ:j+q*;1g ކ?e|43G3N ,~lPM_φtD02[gZLDŽHl̺}2^EV]ecD 'rv)fn7w[%SFQBğڽFOXqJF]t?|?Ť8"2 S7=^4h}c(H 2]kr"{[K PjZ}ڗ`HoNz#HΟQPp7CEcU~Lϩjǎ >=w|y2E m #B VpP*gnޝ>WR#Qss8qC8$y榎+mM%c#F}k _c?0푂3< =i#Ҙ~JŪGHMu- xU0HR:H*Ol.|8~{A\zچwmv_>V\J߻"IxVHoǡ#{?b$oQæF329g8ay|X~z$v6UzRB{Sl,NSW=?:wjbсw>cbd⏤Y#Ԓy|L?ߖDd?Z!-,mwr`¿~8%ü6qX=?cc=^ =8AKX#1ct+k3U#qzWe(.ZJ"§V~Jg]͵y3nTt>8FݷcƜa9Xɟ]/`0Đ@ (D L^wtU$ D!܏8>4\Sʵ?f!L<|Y7P|ȼFy_@Kcڔ-5/"`<JȣEF腞kd 2ʡ]Whv0KUr] >÷Aٚ9=M]yk$֯n$ w""k5 vՑGGrPѿ/11izpyp抵fz"`eD `{Dvf~&^=F@y>ug^K׮ہ2Ch|.zg-Ų9` Puk9RH|¶VS6rXum'cmVcH!Pq/7AcW ,y~^73KLGk47~5!=YO%soǝcZQ}oOnU0xT?F{ٽ9'ɿ_